Mutagenetix > Incidental Mutations

Incidental Mutation 'R1845:Otof'

207630

Institutional Source

Beutler Lab

Gene Symbol

Otof

Ensembl Gene

ENSMUSG00000062372

Gene Name

otoferlin

Synonyms

MMRRC Submission

039870-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.134) question?

Stock #

R1845 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30367062-30461932 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 30371723 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 1775 (Y1775*)

Ref Sequence

ENSEMBL: ENSMUSP00000110395 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000114747]

Predicted Effect

probably null
Transcript: ENSMUST00000074171
AA Change: Y1780*

SMART Domains

Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: Y1780*

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000114747
AA Change: Y1775*

SMART Domains

Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372
AA Change: Y1775*

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	269	367	3.76e-11	SMART
FerI	353	424	7.91e-38	SMART
C2	432	543	1.75e-11	SMART
low complexity region	622	633	N/A	INTRINSIC
FerB	856	932	5.13e-46	SMART
C2	975	1082	1.77e-7	SMART
Pfam:C2	1153	1236	1.8e-1	PFAM
low complexity region	1260	1271	N/A	INTRINSIC
low complexity region	1288	1318	N/A	INTRINSIC
low complexity region	1365	1380	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
C2	1488	1587	6.54e-11	SMART
C2	1728	1858	4.02e0	SMART
low complexity region	1903	1915	N/A	INTRINSIC
transmembrane domain	1959	1981	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144125

SMART Domains

Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150734

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	T	A	12: 55,304,332	I142N	possibly damaging	Het
1110038F14Rik	CGGG	CGGGGGG	15: 76,949,663		probably benign	Het
Abca17	A	T	17: 24,267,716	C1446S	probably damaging	Het
Asb16	C	A	11: 102,276,756	A316E	possibly damaging	Het
Axdnd1	C	T	1: 156,376,544	V384I	possibly damaging	Het
BC024139	A	T	15: 76,125,261	L207*	probably null	Het
Bcl3	T	G	7: 19,809,627	S305R	probably damaging	Het
Cachd1	T	C	4: 100,777,358	V77A	probably benign	Het
Cd101	C	T	3: 101,029,448		probably null	Het
Cela1	T	C	15: 100,685,167	N64S	probably benign	Het
Cep128	T	C	12: 91,289,598	D366G	probably benign	Het
Col12a1	A	G	9: 79,697,541	V675A	probably benign	Het
Copg1	A	G	6: 87,893,818	Y201C	probably damaging	Het
Cyp24a1	T	C	2: 170,487,917	R372G	probably benign	Het
Dcaf1	A	C	9: 106,851,962	I567L	probably benign	Het
Dcn	A	G	10: 97,506,674	D164G	probably benign	Het
Dnase2a	T	A	8: 84,909,322	H113Q	probably benign	Het
Espl1	T	C	15: 102,299,013	V304A	probably benign	Het
Fam193a	A	G	5: 34,443,372	D315G	possibly damaging	Het
Fkbp8	T	A	8: 70,531,035		probably null	Het
Foxp4	T	A	17: 47,877,959	T321S	probably null	Het
Fut10	A	G	8: 31,236,300	N361S	probably damaging	Het
Gm13762	A	G	2: 88,973,138	V251A	probably benign	Het
Gyg	A	T	3: 20,151,122	V94D	probably damaging	Het
Has2	T	C	15: 56,668,578	K247R	probably damaging	Het
Helz2	G	T	2: 181,232,085	D2205E	probably benign	Het
Hps6	T	A	19: 46,004,970	S449T	probably benign	Het
Ints10	T	C	8: 68,794,671	Y64H	probably damaging	Het
Kalrn	T	C	16: 34,356,961	H278R	probably damaging	Het
Klhdc8a	T	C	1: 132,303,810	V280A	possibly damaging	Het
Klk1b5	A	G	7: 44,220,125	M210V	probably benign	Het
Kmt2c	G	A	5: 25,373,436	A614V	probably benign	Het
Lck	T	A	4: 129,558,086	I45F	probably benign	Het
Lin7a	A	C	10: 107,412,059	E75A	probably damaging	Het
Lrp1	A	T	10: 127,578,673	C1070S	probably damaging	Het
Mapk8ip3	G	T	17: 24,914,583	N289K	probably benign	Het
Mbtps1	T	C	8: 119,522,493	D686G	probably benign	Het
Mknk1	T	A	4: 115,873,231	C178*	probably null	Het
Mtmr6	A	G	14: 60,296,735	N474S	probably damaging	Het
Mvb12b	A	G	2: 33,840,157		probably null	Het
Myh6	T	C	14: 54,944,674	K1759R	probably damaging	Het
Nfatc1	T	C	18: 80,635,531	K881E	possibly damaging	Het
Nlrp10	A	G	7: 108,927,041	F30S	probably damaging	Het
Nop14	G	T	5: 34,650,328	A430E	possibly damaging	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Olfr1212	A	G	2: 88,958,867	I134V	probably damaging	Het
Olfr347	A	T	2: 36,734,842	I174F	probably damaging	Het
Olfr775	A	G	10: 129,250,594	E20G	probably benign	Het
Olfr794	A	T	10: 129,571,348	Q231L	probably damaging	Het
Olfr829	A	T	9: 18,857,486	Y287F	possibly damaging	Het
Osbpl7	C	A	11: 97,059,128	S378R	probably damaging	Het
Parp16	T	C	9: 65,215,594	S46P	possibly damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pi16	A	T	17: 29,319,387	Q58L	possibly damaging	Het
Pld3	C	A	7: 27,539,452	M190I	probably benign	Het
Plscr4	T	G	9: 92,490,046	I290S	probably damaging	Het
Ppip5k2	T	C	1: 97,723,806	D928G	possibly damaging	Het
Ppp1r13l	T	A	7: 19,368,611	L15Q	probably damaging	Het
Ptpn14	C	A	1: 189,839,502	S263R	possibly damaging	Het
Sema7a	G	A	9: 57,954,899	V178I	possibly damaging	Het
Sesn2	A	T	4: 132,497,070	Y342*	probably null	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Sltm	A	G	9: 70,543,032	N38S	possibly damaging	Het
Smg1	T	C	7: 118,154,622		probably benign	Het
Spsb1	A	T	4: 149,906,910	V67E	probably damaging	Het
Suox	A	G	10: 128,670,539	V540A	possibly damaging	Het
Tbc1d12	T	A	19: 38,911,085	I483N	probably damaging	Het
Tbcb	A	T	7: 30,224,499	D198E	possibly damaging	Het
Tbce	T	C	13: 14,019,709	K122E	probably benign	Het
Tcap	T	A	11: 98,384,379	L113H	probably damaging	Het
Thsd7a	A	T	6: 12,321,041	I1545N	probably damaging	Het
Tmed10	T	C	12: 85,374,503	T55A	possibly damaging	Het
Tmem268	T	A	4: 63,579,943	V200D	probably damaging	Het
Tmem45b	A	C	9: 31,431,355	I50M	probably damaging	Het
Trp53bp2	T	C	1: 182,458,903	W1103R	probably damaging	Het
Ttn	C	T	2: 76,764,033	V20524M	probably damaging	Het
Ulk2	A	T	11: 61,812,738	N379K	probably benign	Het
Vmn1r59	A	G	7: 5,454,554	V69A	probably benign	Het
Vmn2r10	A	T	5: 109,001,995	Y394*	probably null	Het
Zfp212	T	C	6: 47,931,541	S485P	probably benign	Het
Zfp512b	A	T	2: 181,585,735	C776S	probably damaging	Het
Zfp518b	A	G	5: 38,671,741	Y974H	probably damaging	Het

Other mutations in Otof

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Otof	APN	5	30375904	missense	probably damaging	1.00
IGL00391:Otof	APN	5	30375623	missense	probably damaging	1.00
IGL00579:Otof	APN	5	30399322	missense	possibly damaging	0.88
IGL00671:Otof	APN	5	30385753	critical splice donor site	probably null
IGL01019:Otof	APN	5	30405216	missense	probably benign	0.01
IGL01025:Otof	APN	5	30384253	missense	possibly damaging	0.82
IGL01086:Otof	APN	5	30376273	critical splice donor site	probably null
IGL01110:Otof	APN	5	30461725	missense	probably damaging	1.00
IGL01160:Otof	APN	5	30381535	missense	probably benign	0.00
IGL01285:Otof	APN	5	30405183	missense	probably damaging	1.00
IGL01329:Otof	APN	5	30441379	missense	probably benign	0.00
IGL01337:Otof	APN	5	30405777	missense	possibly damaging	0.93
IGL01337:Otof	APN	5	30419512	missense	probably benign	0.17
IGL01834:Otof	APN	5	30399220	missense	probably damaging	1.00
IGL01872:Otof	APN	5	30379254	splice site	probably benign
IGL01969:Otof	APN	5	30382483	splice site	probably benign
IGL02075:Otof	APN	5	30370726	missense	probably benign	0.23
IGL02077:Otof	APN	5	30399235	missense	probably damaging	1.00
IGL02136:Otof	APN	5	30373992	missense	possibly damaging	0.90
IGL02227:Otof	APN	5	30370784	missense	probably damaging	1.00
IGL02475:Otof	APN	5	30376682	missense	probably damaging	1.00
IGL02812:Otof	APN	5	30374082	missense	probably benign	0.08
IGL02864:Otof	APN	5	30386341	missense	probably damaging	0.99
IGL03176:Otof	APN	5	30405176	splice site	probably null
R0285:Otof	UTSW	5	30379533	critical splice donor site	probably null
R0421:Otof	UTSW	5	30371568	missense	possibly damaging	0.94
R0570:Otof	UTSW	5	30371881	splice site	probably benign
R0599:Otof	UTSW	5	30370705	missense	probably damaging	1.00
R0675:Otof	UTSW	5	30382361	missense	probably benign	0.01
R0715:Otof	UTSW	5	30394697	missense	probably damaging	0.99
R1019:Otof	UTSW	5	30370743	missense	probably damaging	0.96
R1183:Otof	UTSW	5	30371912	missense	probably damaging	1.00
R1435:Otof	UTSW	5	30378695	missense	probably benign	0.00
R1469:Otof	UTSW	5	30380227	missense	probably benign	0.00
R1469:Otof	UTSW	5	30380227	missense	probably benign	0.00
R1474:Otof	UTSW	5	30379532	critical splice donor site	probably null
R1524:Otof	UTSW	5	30379556	missense	probably benign	0.03
R1563:Otof	UTSW	5	30371005	missense	probably benign	0.00
R1732:Otof	UTSW	5	30386471	missense	probably damaging	1.00
R1822:Otof	UTSW	5	30378710	missense	probably benign	0.00
R1925:Otof	UTSW	5	30394188	missense	probably benign	0.37
R1938:Otof	UTSW	5	30376369	missense	probably benign	0.00
R1968:Otof	UTSW	5	30388654	missense	probably damaging	1.00
R1996:Otof	UTSW	5	30421037	missense	probably benign	0.01
R1999:Otof	UTSW	5	30388772	missense	probably benign	0.19
R2027:Otof	UTSW	5	30421014	missense	probably benign	0.08
R2138:Otof	UTSW	5	30461770	missense	probably benign	0.01
R2173:Otof	UTSW	5	30386374	missense	probably damaging	1.00
R2245:Otof	UTSW	5	30370207	missense	probably damaging	1.00
R3011:Otof	UTSW	5	30382840	missense	probably damaging	1.00
R3105:Otof	UTSW	5	30381801	missense	probably benign	0.03
R3442:Otof	UTSW	5	30371689	missense	probably damaging	1.00
R3710:Otof	UTSW	5	30385266	missense	probably benign
R3715:Otof	UTSW	5	30376871	nonsense	probably null
R3806:Otof	UTSW	5	30386499	critical splice acceptor site	probably null
R3975:Otof	UTSW	5	30370712	missense	probably damaging	1.00
R4067:Otof	UTSW	5	30399291	missense	probably damaging	1.00
R4077:Otof	UTSW	5	30419506	missense	possibly damaging	0.89
R4166:Otof	UTSW	5	30382418	missense	probably damaging	1.00
R4451:Otof	UTSW	5	30385164	missense	possibly damaging	0.77
R4485:Otof	UTSW	5	30375000	missense	possibly damaging	0.77
R4600:Otof	UTSW	5	30371900	missense	probably damaging	1.00
R4646:Otof	UTSW	5	30383570	missense	possibly damaging	0.82
R4648:Otof	UTSW	5	30383570	missense	possibly damaging	0.82
R4669:Otof	UTSW	5	30420974	critical splice donor site	probably null
R4773:Otof	UTSW	5	30394682	missense	probably benign	0.05
R4839:Otof	UTSW	5	30419404	missense	probably damaging	0.99
R4907:Otof	UTSW	5	30378661	critical splice donor site	probably null
R4961:Otof	UTSW	5	30383493	intron	probably benign
R4991:Otof	UTSW	5	30394181	missense	probably damaging	1.00
R5015:Otof	UTSW	5	30382894	missense	probably damaging	1.00
R5036:Otof	UTSW	5	30384439	missense	possibly damaging	0.54
R5038:Otof	UTSW	5	30384439	missense	possibly damaging	0.54
R5253:Otof	UTSW	5	30370139	missense	probably damaging	1.00
R5336:Otof	UTSW	5	30376720	missense	probably benign	0.01
R5365:Otof	UTSW	5	30381800	missense	probably damaging	0.99
R5901:Otof	UTSW	5	30374979	missense	probably damaging	1.00
R6211:Otof	UTSW	5	30371900	missense	probably damaging	0.99
R6318:Otof	UTSW	5	30414544	missense	probably damaging	1.00
R6331:Otof	UTSW	5	30371935	missense	possibly damaging	0.94
R6671:Otof	UTSW	5	30419533	missense	probably benign
R6701:Otof	UTSW	5	30370797	nonsense	probably null
R6792:Otof	UTSW	5	30375634	missense	probably damaging	1.00
R6853:Otof	UTSW	5	30388239	missense	probably damaging	1.00
R6940:Otof	UTSW	5	30371643	missense	probably damaging	0.96
R7037:Otof	UTSW	5	30381538	missense	probably benign	0.32
R7060:Otof	UTSW	5	30388356	missense	possibly damaging	0.84
R7089:Otof	UTSW	5	30371568	missense	possibly damaging	0.94
R7165:Otof	UTSW	5	30375620	missense	probably damaging	0.99
R7178:Otof	UTSW	5	30383534	missense	possibly damaging	0.50
R7298:Otof	UTSW	5	30388270	missense	probably damaging	1.00
R7393:Otof	UTSW	5	30370270	missense	probably benign	0.45
R7397:Otof	UTSW	5	30375707	missense	probably damaging	1.00
R7400:Otof	UTSW	5	30385188	missense	probably benign	0.04
R7428:Otof	UTSW	5	30389825	missense	probably damaging	1.00
R7456:Otof	UTSW	5	30394661	missense	probably damaging	1.00
R7505:Otof	UTSW	5	30371020	missense	probably benign	0.00
R7714:Otof	UTSW	5	30370253	missense	probably damaging	0.99
R8002:Otof	UTSW	5	30380610	missense	probably benign	0.10
R8032:Otof	UTSW	5	30461798	start codon destroyed	probably benign	0.07
R8153:Otof	UTSW	5	30388735	missense	probably damaging	1.00
R8158:Otof	UTSW	5	30380194	missense	probably benign	0.37
R8159:Otof	UTSW	5	30380194	missense	probably benign	0.37
R8441:Otof	UTSW	5	30380856	missense	probably damaging	0.99
Z1176:Otof	UTSW	5	30371586	missense	probably damaging	0.98
Z1177:Otof	UTSW	5	30376297	missense	probably damaging	1.00
Z1177:Otof	UTSW	5	30383658	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCTGGCTCTGAGGACTAG -3'
(R):5'- TTCACGGGAGAGAAGTCCAG -3'

Sequencing Primer
(F):5'- TCTGAGGACTAGGTGACCCCTC -3'
(R):5'- GAGAGAAGTCCAGTGACATTTTTG -3'

Posted On

2014-06-23