Mutagenetix > Incidental Mutations

Incidental Mutation 'R1845:Thsd7a'

207636

Institutional Source

Beutler Lab

Gene Symbol

Thsd7a

Ensembl Gene

ENSMUSG00000032625

Gene Name

thrombospondin, type I, domain containing 7A

Synonyms

LOC330267

MMRRC Submission

039870-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1845 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12311610-12749410 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 12321041 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1545 (I1545N)

Ref Sequence

ENSEMBL: ENSMUSP00000131662 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119581] [ENSMUST00000172356]

Predicted Effect

probably damaging
Transcript: ENSMUST00000046121
AA Change: I1545N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000040176
Gene: ENSMUSG00000032625
AA Change: I1545N

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1084	1.2e-7	SMART
TSP1	1087	1152	5.82e-1	SMART
TSP1	1157	1209	4.24e-2	SMART
TSP1	1212	1273	1e0	SMART
TSP1	1278	1330	3.55e-10	SMART
TSP1	1331	1401	7.5e-2	SMART
TSP1	1406	1464	1.55e-1	SMART
transmembrane domain	1596	1618	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000119581
AA Change: I1545N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000113681
Gene: ENSMUSG00000032625
AA Change: I1545N

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1082	9.09e-8	SMART
TSP1	1085	1150	5.82e-1	SMART
TSP1	1155	1207	4.24e-2	SMART
TSP1	1210	1271	1e0	SMART
TSP1	1276	1328	3.55e-10	SMART
TSP1	1329	1399	7.5e-2	SMART
TSP1	1404	1462	1.55e-1	SMART
transmembrane domain	1594	1616	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122369

SMART Domains

Protein: ENSMUSP00000112503
Gene: ENSMUSG00000032625

Domain	Start	End	E-Value	Type
TSP1	43	100	6.24e-6	SMART
TSP1	178	228	7.31e-2	SMART
Blast:TSP1	232	302	4e-26	BLAST
TSP1	307	362	9.09e-8	SMART
TSP1	365	430	5.82e-1	SMART
TSP1	435	487	4.24e-2	SMART
TSP1	490	551	1e0	SMART
TSP1	556	608	3.55e-10	SMART
TSP1	609	679	7.5e-2	SMART
TSP1	684	742	1.55e-1	SMART
transmembrane domain	874	896	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135450

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137836

Predicted Effect

probably damaging
Transcript: ENSMUST00000172356
AA Change: I1545N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000131662
Gene: ENSMUSG00000032625
AA Change: I1545N

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1084	1.95e-7	SMART
TSP1	1087	1152	5.82e-1	SMART
TSP1	1157	1209	4.24e-2	SMART
TSP1	1212	1273	1e0	SMART
TSP1	1278	1330	3.55e-10	SMART
TSP1	1331	1401	7.5e-2	SMART
TSP1	1406	1464	1.55e-1	SMART
transmembrane domain	1596	1618	N/A	INTRINSIC

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found almost exclusively in endothelial cells from placenta and umbilical cord. The encoded protein appears to interact with alpha(V)beta(3) integrin and paxillin to inhibit endothelial cell migration and tube formation. This protein may be involved in cytoskeletal organization. Variations in this gene may be associated with low bone mineral density in osteoporosis. [provided by RefSeq, Aug 2010]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	T	A	12: 55,304,332	I142N	possibly damaging	Het
1110038F14Rik	CGGG	CGGGGGG	15: 76,949,663		probably benign	Het
Abca17	A	T	17: 24,267,716	C1446S	probably damaging	Het
Asb16	C	A	11: 102,276,756	A316E	possibly damaging	Het
Axdnd1	C	T	1: 156,376,544	V384I	possibly damaging	Het
BC024139	A	T	15: 76,125,261	L207*	probably null	Het
Bcl3	T	G	7: 19,809,627	S305R	probably damaging	Het
Cachd1	T	C	4: 100,777,358	V77A	probably benign	Het
Cd101	C	T	3: 101,029,448		probably null	Het
Cela1	T	C	15: 100,685,167	N64S	probably benign	Het
Cep128	T	C	12: 91,289,598	D366G	probably benign	Het
Col12a1	A	G	9: 79,697,541	V675A	probably benign	Het
Copg1	A	G	6: 87,893,818	Y201C	probably damaging	Het
Cyp24a1	T	C	2: 170,487,917	R372G	probably benign	Het
Dcaf1	A	C	9: 106,851,962	I567L	probably benign	Het
Dcn	A	G	10: 97,506,674	D164G	probably benign	Het
Dnase2a	T	A	8: 84,909,322	H113Q	probably benign	Het
Espl1	T	C	15: 102,299,013	V304A	probably benign	Het
Fam193a	A	G	5: 34,443,372	D315G	possibly damaging	Het
Fkbp8	T	A	8: 70,531,035		probably null	Het
Foxp4	T	A	17: 47,877,959	T321S	probably null	Het
Fut10	A	G	8: 31,236,300	N361S	probably damaging	Het
Gm13762	A	G	2: 88,973,138	V251A	probably benign	Het
Gyg	A	T	3: 20,151,122	V94D	probably damaging	Het
Has2	T	C	15: 56,668,578	K247R	probably damaging	Het
Helz2	G	T	2: 181,232,085	D2205E	probably benign	Het
Hps6	T	A	19: 46,004,970	S449T	probably benign	Het
Ints10	T	C	8: 68,794,671	Y64H	probably damaging	Het
Kalrn	T	C	16: 34,356,961	H278R	probably damaging	Het
Klhdc8a	T	C	1: 132,303,810	V280A	possibly damaging	Het
Klk1b5	A	G	7: 44,220,125	M210V	probably benign	Het
Kmt2c	G	A	5: 25,373,436	A614V	probably benign	Het
Lck	T	A	4: 129,558,086	I45F	probably benign	Het
Lin7a	A	C	10: 107,412,059	E75A	probably damaging	Het
Lrp1	A	T	10: 127,578,673	C1070S	probably damaging	Het
Mapk8ip3	G	T	17: 24,914,583	N289K	probably benign	Het
Mbtps1	T	C	8: 119,522,493	D686G	probably benign	Het
Mknk1	T	A	4: 115,873,231	C178*	probably null	Het
Mtmr6	A	G	14: 60,296,735	N474S	probably damaging	Het
Mvb12b	A	G	2: 33,840,157		probably null	Het
Myh6	T	C	14: 54,944,674	K1759R	probably damaging	Het
Nfatc1	T	C	18: 80,635,531	K881E	possibly damaging	Het
Nlrp10	A	G	7: 108,927,041	F30S	probably damaging	Het
Nop14	G	T	5: 34,650,328	A430E	possibly damaging	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Olfr1212	A	G	2: 88,958,867	I134V	probably damaging	Het
Olfr347	A	T	2: 36,734,842	I174F	probably damaging	Het
Olfr775	A	G	10: 129,250,594	E20G	probably benign	Het
Olfr794	A	T	10: 129,571,348	Q231L	probably damaging	Het
Olfr829	A	T	9: 18,857,486	Y287F	possibly damaging	Het
Osbpl7	C	A	11: 97,059,128	S378R	probably damaging	Het
Otof	A	T	5: 30,371,723	Y1775*	probably null	Het
Parp16	T	C	9: 65,215,594	S46P	possibly damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pi16	A	T	17: 29,319,387	Q58L	possibly damaging	Het
Pld3	C	A	7: 27,539,452	M190I	probably benign	Het
Plscr4	T	G	9: 92,490,046	I290S	probably damaging	Het
Ppip5k2	T	C	1: 97,723,806	D928G	possibly damaging	Het
Ppp1r13l	T	A	7: 19,368,611	L15Q	probably damaging	Het
Ptpn14	C	A	1: 189,839,502	S263R	possibly damaging	Het
Sema7a	G	A	9: 57,954,899	V178I	possibly damaging	Het
Sesn2	A	T	4: 132,497,070	Y342*	probably null	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Sltm	A	G	9: 70,543,032	N38S	possibly damaging	Het
Smg1	T	C	7: 118,154,622		probably benign	Het
Spsb1	A	T	4: 149,906,910	V67E	probably damaging	Het
Suox	A	G	10: 128,670,539	V540A	possibly damaging	Het
Tbc1d12	T	A	19: 38,911,085	I483N	probably damaging	Het
Tbcb	A	T	7: 30,224,499	D198E	possibly damaging	Het
Tbce	T	C	13: 14,019,709	K122E	probably benign	Het
Tcap	T	A	11: 98,384,379	L113H	probably damaging	Het
Tmed10	T	C	12: 85,374,503	T55A	possibly damaging	Het
Tmem268	T	A	4: 63,579,943	V200D	probably damaging	Het
Tmem45b	A	C	9: 31,431,355	I50M	probably damaging	Het
Trp53bp2	T	C	1: 182,458,903	W1103R	probably damaging	Het
Ttn	C	T	2: 76,764,033	V20524M	probably damaging	Het
Ulk2	A	T	11: 61,812,738	N379K	probably benign	Het
Vmn1r59	A	G	7: 5,454,554	V69A	probably benign	Het
Vmn2r10	A	T	5: 109,001,995	Y394*	probably null	Het
Zfp212	T	C	6: 47,931,541	S485P	probably benign	Het
Zfp512b	A	T	2: 181,585,735	C776S	probably damaging	Het
Zfp518b	A	G	5: 38,671,741	Y974H	probably damaging	Het

Other mutations in Thsd7a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00562:Thsd7a	APN	6	12379659	splice site	probably null
IGL00563:Thsd7a	APN	6	12379659	splice site	probably null
IGL00753:Thsd7a	APN	6	12327529	missense	probably damaging	1.00
IGL00835:Thsd7a	APN	6	12554934	missense	probably damaging	1.00
IGL01486:Thsd7a	APN	6	12471080	missense	probably damaging	1.00
IGL01730:Thsd7a	APN	6	12554981	missense	probably benign	0.05
IGL01931:Thsd7a	APN	6	12504099	missense	probably damaging	1.00
IGL01935:Thsd7a	APN	6	12317419	missense	probably damaging	1.00
IGL01978:Thsd7a	APN	6	12331006	missense	probably benign	0.01
IGL02233:Thsd7a	APN	6	12555258	missense	probably benign	0.00
IGL02354:Thsd7a	APN	6	12348193	splice site	probably benign
IGL02361:Thsd7a	APN	6	12348193	splice site	probably benign
IGL02375:Thsd7a	APN	6	12343265	missense	probably damaging	1.00
IGL02468:Thsd7a	APN	6	12318171	missense	probably damaging	0.98
IGL02616:Thsd7a	APN	6	12408985	missense	probably damaging	0.98
IGL02820:Thsd7a	APN	6	12321072	missense	probably damaging	1.00
IGL02858:Thsd7a	APN	6	12500995	missense	probably benign	0.16
IGL03074:Thsd7a	APN	6	12324681	missense	probably damaging	0.99
IGL03234:Thsd7a	APN	6	12343178	missense	probably damaging	1.00
IGL03244:Thsd7a	APN	6	12504168	splice site	probably benign
IGL03337:Thsd7a	APN	6	12405174	missense	probably damaging	1.00
PIT4354001:Thsd7a	UTSW	6	12331927	critical splice donor site	probably null
R0095:Thsd7a	UTSW	6	12320970	missense	probably damaging	0.99
R0127:Thsd7a	UTSW	6	12554908	missense	probably benign	0.01
R0142:Thsd7a	UTSW	6	12418335	missense	probably damaging	1.00
R0226:Thsd7a	UTSW	6	12321900	missense	possibly damaging	0.94
R0242:Thsd7a	UTSW	6	12503916	missense	probably benign	0.32
R0242:Thsd7a	UTSW	6	12503916	missense	probably benign	0.32
R0359:Thsd7a	UTSW	6	12352031	missense	probably damaging	1.00
R0365:Thsd7a	UTSW	6	12321887	critical splice donor site	probably null
R0504:Thsd7a	UTSW	6	12379594	missense	probably damaging	0.99
R0512:Thsd7a	UTSW	6	12379605	missense	possibly damaging	0.67
R0540:Thsd7a	UTSW	6	12331542	splice site	probably null
R0577:Thsd7a	UTSW	6	12321048	missense	possibly damaging	0.50
R0607:Thsd7a	UTSW	6	12331542	splice site	probably null
R0755:Thsd7a	UTSW	6	12555369	missense	probably damaging	1.00
R0771:Thsd7a	UTSW	6	12327577	missense	probably benign	0.09
R0780:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0870:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0871:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0872:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0873:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R1102:Thsd7a	UTSW	6	12555702	missense	possibly damaging	0.58
R1144:Thsd7a	UTSW	6	12471027	splice site	probably benign
R1265:Thsd7a	UTSW	6	12317419	missense	probably damaging	0.99
R1276:Thsd7a	UTSW	6	12418370	missense	probably damaging	1.00
R1381:Thsd7a	UTSW	6	12555439	missense	probably damaging	1.00
R1473:Thsd7a	UTSW	6	12338622	missense	probably benign	0.08
R1519:Thsd7a	UTSW	6	12471175	missense	probably benign	0.01
R1633:Thsd7a	UTSW	6	12471104	nonsense	probably null
R1659:Thsd7a	UTSW	6	12504064	missense	possibly damaging	0.73
R1769:Thsd7a	UTSW	6	12555715	nonsense	probably null
R1824:Thsd7a	UTSW	6	12409042	splice site	probably null
R1840:Thsd7a	UTSW	6	12330974	missense	probably benign	0.03
R1874:Thsd7a	UTSW	6	12555435	missense	possibly damaging	0.76
R2023:Thsd7a	UTSW	6	12327536	missense	probably benign	0.16
R2039:Thsd7a	UTSW	6	12408923	missense	possibly damaging	0.77
R2058:Thsd7a	UTSW	6	12318106	splice site	probably benign
R2138:Thsd7a	UTSW	6	12471073	nonsense	probably null
R2155:Thsd7a	UTSW	6	12379633	missense	probably damaging	1.00
R2175:Thsd7a	UTSW	6	12331944	missense	possibly damaging	0.95
R2216:Thsd7a	UTSW	6	12337268	missense	possibly damaging	0.95
R2318:Thsd7a	UTSW	6	12405147	missense	probably damaging	1.00
R2375:Thsd7a	UTSW	6	12337362	missense	probably damaging	1.00
R3857:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R3858:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R3890:Thsd7a	UTSW	6	12418337	missense	probably benign	0.09
R3910:Thsd7a	UTSW	6	12331549	missense	probably damaging	0.96
R3933:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R4369:Thsd7a	UTSW	6	12468908	missense	probably damaging	1.00
R4447:Thsd7a	UTSW	6	12324635	missense	probably damaging	0.98
R4664:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4664:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4665:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4665:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4666:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4666:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4668:Thsd7a	UTSW	6	12408968	missense	probably damaging	0.98
R4886:Thsd7a	UTSW	6	12327660	nonsense	probably null
R4918:Thsd7a	UTSW	6	12327559	missense	probably damaging	1.00
R4938:Thsd7a	UTSW	6	12330992	missense	probably benign	0.09
R5064:Thsd7a	UTSW	6	12330952	missense	possibly damaging	0.66
R5153:Thsd7a	UTSW	6	12338655	missense	probably benign	0.00
R5177:Thsd7a	UTSW	6	12379583	nonsense	probably null
R5242:Thsd7a	UTSW	6	12327583	missense	probably damaging	1.00
R5267:Thsd7a	UTSW	6	12379602	missense	probably damaging	1.00
R5442:Thsd7a	UTSW	6	12748800	missense	probably benign	0.00
R5506:Thsd7a	UTSW	6	12332017	missense	possibly damaging	0.85
R5525:Thsd7a	UTSW	6	12332007	missense	possibly damaging	0.52
R5544:Thsd7a	UTSW	6	12379471	missense	possibly damaging	0.94
R5651:Thsd7a	UTSW	6	12343213	missense	probably damaging	1.00
R5716:Thsd7a	UTSW	6	12343148	missense	probably benign	0.00
R5848:Thsd7a	UTSW	6	12503923	missense	probably damaging	1.00
R5958:Thsd7a	UTSW	6	12337262	missense	probably benign	0.02
R6012:Thsd7a	UTSW	6	12379389	splice site	probably null
R6139:Thsd7a	UTSW	6	12379573	missense	possibly damaging	0.93
R6243:Thsd7a	UTSW	6	12327602	missense	probably damaging	1.00
R6257:Thsd7a	UTSW	6	12408988	nonsense	probably null
R6273:Thsd7a	UTSW	6	12408836	missense	probably damaging	0.99
R6300:Thsd7a	UTSW	6	12471104	nonsense	probably null
R6314:Thsd7a	UTSW	6	12554997	missense	possibly damaging	0.87
R6392:Thsd7a	UTSW	6	12468929	missense	probably damaging	0.99
R6418:Thsd7a	UTSW	6	12555082	nonsense	probably null
R6515:Thsd7a	UTSW	6	12501086	missense	possibly damaging	0.47
R6725:Thsd7a	UTSW	6	12555631	missense	possibly damaging	0.87
R6742:Thsd7a	UTSW	6	12408816	missense	probably damaging	1.00
R6776:Thsd7a	UTSW	6	12555637	missense	possibly damaging	0.53
R6838:Thsd7a	UTSW	6	12504075	missense	probably damaging	0.99
R7104:Thsd7a	UTSW	6	12379430	missense
R7170:Thsd7a	UTSW	6	12352091	missense
R7349:Thsd7a	UTSW	6	12352068	missense
R7460:Thsd7a	UTSW	6	12554934	missense
R7467:Thsd7a	UTSW	6	12331585	missense
R7666:Thsd7a	UTSW	6	12379438	missense

Predicted Primers

PCR Primer
(F):5'- GAGTCCATGGGTTGAGAAATAATC -3'
(R):5'- AAAATGCTTCCTAATGCTCGTTTC -3'

Sequencing Primer
(F):5'- ACTGTGATATTGGTGGAACGTCTAAG -3'
(R):5'- ATGCTCGTTTCTCTGAGTAAACG -3'

Posted On

2014-06-23