Incidental Mutation 'R1845:Vmn1r59'
ID207639
Institutional Source Beutler Lab
Gene Symbol Vmn1r59
Ensembl Gene ENSMUSG00000074401
Gene Namevomeronasal 1 receptor 59
SynonymsV1rd10
MMRRC Submission 039870-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1845 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location5453400-5454838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5454554 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 69 (V69A)
Ref Sequence ENSEMBL: ENSMUSP00000073768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074132]
Predicted Effect probably benign
Transcript: ENSMUST00000074132
AA Change: V69A

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000073768
Gene: ENSMUSG00000074401
AA Change: V69A

DomainStartEndE-ValueType
Pfam:TAS2R 1 289 2e-14 PFAM
Pfam:7tm_1 20 279 1.9e-6 PFAM
Pfam:V1R 31 287 3e-16 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,304,332 I142N possibly damaging Het
1110038F14Rik CGGG CGGGGGG 15: 76,949,663 probably benign Het
Abca17 A T 17: 24,267,716 C1446S probably damaging Het
Asb16 C A 11: 102,276,756 A316E possibly damaging Het
Axdnd1 C T 1: 156,376,544 V384I possibly damaging Het
BC024139 A T 15: 76,125,261 L207* probably null Het
Bcl3 T G 7: 19,809,627 S305R probably damaging Het
Cachd1 T C 4: 100,777,358 V77A probably benign Het
Cd101 C T 3: 101,029,448 probably null Het
Cela1 T C 15: 100,685,167 N64S probably benign Het
Cep128 T C 12: 91,289,598 D366G probably benign Het
Col12a1 A G 9: 79,697,541 V675A probably benign Het
Copg1 A G 6: 87,893,818 Y201C probably damaging Het
Cyp24a1 T C 2: 170,487,917 R372G probably benign Het
Dcaf1 A C 9: 106,851,962 I567L probably benign Het
Dcn A G 10: 97,506,674 D164G probably benign Het
Dnase2a T A 8: 84,909,322 H113Q probably benign Het
Espl1 T C 15: 102,299,013 V304A probably benign Het
Fam193a A G 5: 34,443,372 D315G possibly damaging Het
Fkbp8 T A 8: 70,531,035 probably null Het
Foxp4 T A 17: 47,877,959 T321S probably null Het
Fut10 A G 8: 31,236,300 N361S probably damaging Het
Gm13762 A G 2: 88,973,138 V251A probably benign Het
Gyg A T 3: 20,151,122 V94D probably damaging Het
Has2 T C 15: 56,668,578 K247R probably damaging Het
Helz2 G T 2: 181,232,085 D2205E probably benign Het
Hps6 T A 19: 46,004,970 S449T probably benign Het
Ints10 T C 8: 68,794,671 Y64H probably damaging Het
Kalrn T C 16: 34,356,961 H278R probably damaging Het
Klhdc8a T C 1: 132,303,810 V280A possibly damaging Het
Klk1b5 A G 7: 44,220,125 M210V probably benign Het
Kmt2c G A 5: 25,373,436 A614V probably benign Het
Lck T A 4: 129,558,086 I45F probably benign Het
Lin7a A C 10: 107,412,059 E75A probably damaging Het
Lrp1 A T 10: 127,578,673 C1070S probably damaging Het
Mapk8ip3 G T 17: 24,914,583 N289K probably benign Het
Mbtps1 T C 8: 119,522,493 D686G probably benign Het
Mknk1 T A 4: 115,873,231 C178* probably null Het
Mtmr6 A G 14: 60,296,735 N474S probably damaging Het
Mvb12b A G 2: 33,840,157 probably null Het
Myh6 T C 14: 54,944,674 K1759R probably damaging Het
Nfatc1 T C 18: 80,635,531 K881E possibly damaging Het
Nlrp10 A G 7: 108,927,041 F30S probably damaging Het
Nop14 G T 5: 34,650,328 A430E possibly damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1212 A G 2: 88,958,867 I134V probably damaging Het
Olfr347 A T 2: 36,734,842 I174F probably damaging Het
Olfr775 A G 10: 129,250,594 E20G probably benign Het
Olfr794 A T 10: 129,571,348 Q231L probably damaging Het
Olfr829 A T 9: 18,857,486 Y287F possibly damaging Het
Osbpl7 C A 11: 97,059,128 S378R probably damaging Het
Otof A T 5: 30,371,723 Y1775* probably null Het
Parp16 T C 9: 65,215,594 S46P possibly damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pi16 A T 17: 29,319,387 Q58L possibly damaging Het
Pld3 C A 7: 27,539,452 M190I probably benign Het
Plscr4 T G 9: 92,490,046 I290S probably damaging Het
Ppip5k2 T C 1: 97,723,806 D928G possibly damaging Het
Ppp1r13l T A 7: 19,368,611 L15Q probably damaging Het
Ptpn14 C A 1: 189,839,502 S263R possibly damaging Het
Sema7a G A 9: 57,954,899 V178I possibly damaging Het
Sesn2 A T 4: 132,497,070 Y342* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sltm A G 9: 70,543,032 N38S possibly damaging Het
Smg1 T C 7: 118,154,622 probably benign Het
Spsb1 A T 4: 149,906,910 V67E probably damaging Het
Suox A G 10: 128,670,539 V540A possibly damaging Het
Tbc1d12 T A 19: 38,911,085 I483N probably damaging Het
Tbcb A T 7: 30,224,499 D198E possibly damaging Het
Tbce T C 13: 14,019,709 K122E probably benign Het
Tcap T A 11: 98,384,379 L113H probably damaging Het
Thsd7a A T 6: 12,321,041 I1545N probably damaging Het
Tmed10 T C 12: 85,374,503 T55A possibly damaging Het
Tmem268 T A 4: 63,579,943 V200D probably damaging Het
Tmem45b A C 9: 31,431,355 I50M probably damaging Het
Trp53bp2 T C 1: 182,458,903 W1103R probably damaging Het
Ttn C T 2: 76,764,033 V20524M probably damaging Het
Ulk2 A T 11: 61,812,738 N379K probably benign Het
Vmn2r10 A T 5: 109,001,995 Y394* probably null Het
Zfp212 T C 6: 47,931,541 S485P probably benign Het
Zfp512b A T 2: 181,585,735 C776S probably damaging Het
Zfp518b A G 5: 38,671,741 Y974H probably damaging Het
Other mutations in Vmn1r59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01684:Vmn1r59 APN 7 5454300 missense probably benign 0.12
IGL02035:Vmn1r59 APN 7 5454209 missense possibly damaging 0.87
IGL02039:Vmn1r59 APN 7 5454381 missense probably benign 0.23
IGL02812:Vmn1r59 APN 7 5454177 missense probably damaging 1.00
R0033:Vmn1r59 UTSW 7 5454434 missense probably benign 0.08
R0115:Vmn1r59 UTSW 7 5454116 missense probably benign 0.07
R1164:Vmn1r59 UTSW 7 5454411 missense probably benign 0.00
R1629:Vmn1r59 UTSW 7 5454467 missense probably damaging 1.00
R1969:Vmn1r59 UTSW 7 5454039 missense probably damaging 1.00
R1970:Vmn1r59 UTSW 7 5454039 missense probably damaging 1.00
R1971:Vmn1r59 UTSW 7 5454039 missense probably damaging 1.00
R2011:Vmn1r59 UTSW 7 5454284 missense probably damaging 1.00
R3712:Vmn1r59 UTSW 7 5454638 missense probably damaging 0.99
R4580:Vmn1r59 UTSW 7 5454137 missense probably damaging 0.98
R4593:Vmn1r59 UTSW 7 5454687 missense possibly damaging 0.46
R4697:Vmn1r59 UTSW 7 5454452 missense probably damaging 1.00
R4856:Vmn1r59 UTSW 7 5454533 missense possibly damaging 0.92
R4873:Vmn1r59 UTSW 7 5454109 missense probably benign
R4875:Vmn1r59 UTSW 7 5454109 missense probably benign
R4925:Vmn1r59 UTSW 7 5454116 missense probably benign 0.07
R5319:Vmn1r59 UTSW 7 5454210 missense probably damaging 0.99
R6239:Vmn1r59 UTSW 7 5454540 missense probably damaging 1.00
R6533:Vmn1r59 UTSW 7 5454464 missense probably benign 0.00
R6912:Vmn1r59 UTSW 7 5454600 missense probably benign 0.01
R7023:Vmn1r59 UTSW 7 5454478 missense probably benign 0.37
R7205:Vmn1r59 UTSW 7 5454726 missense probably damaging 1.00
R7374:Vmn1r59 UTSW 7 5454161 missense probably damaging 0.99
R7390:Vmn1r59 UTSW 7 5453987 missense possibly damaging 0.59
R7776:Vmn1r59 UTSW 7 5454635 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AATAGCTCACGACCTTGGGG -3'
(R):5'- GAAGCCATGTCCATGTTGTC -3'

Sequencing Primer
(F):5'- GGGGATATTTCTCTGAACATGACCC -3'
(R):5'- CCATGGAAATGTTGGCTCTTCAGATC -3'
Posted On2014-06-23