Mutagenetix > Incidental Mutations

Incidental Mutation 'R1845:Bcl3'

207641

Institutional Source

Beutler Lab

Gene Symbol

Bcl3

Ensembl Gene

ENSMUSG00000053175

Gene Name

B cell leukemia/lymphoma 3

Synonyms

Bcl-3

MMRRC Submission

039870-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1845 (G1)

Quality Score

124

Status

Not validated

Chromosome

Chromosomal Location

19808462-19822770 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 19809627 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 305 (S305R)

Ref Sequence

ENSEMBL: ENSMUSP00000113851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120537] [ENSMUST00000135609]

Predicted Effect

probably damaging
Transcript: ENSMUST00000120537
AA Change: S305R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000113851
Gene: ENSMUSG00000053175
AA Change: S305R

Domain	Start	End	E-Value	Type
ANK	129	162	4.01e0	SMART
ANK	166	195	4.43e-2	SMART
ANK	199	230	8.99e-3	SMART
ANK	236	265	3.23e-4	SMART
ANK	270	299	5.79e-6	SMART
ANK	303	332	1.4e1	SMART
low complexity region	377	402	N/A	INTRINSIC
low complexity region	425	447	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123375

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128181

Predicted Effect

possibly damaging
Transcript: ENSMUST00000135609
AA Change: S13R

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000117754
Gene: ENSMUSG00000053175
AA Change: S13R

Domain	Start	End	E-Value	Type
Pfam:Ank_5	1	52	7.2e-7	PFAM
low complexity region	85	94	N/A	INTRINSIC
low complexity region	100	114	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139680

SMART Domains

Protein: ENSMUSP00000116129
Gene: ENSMUSG00000053175

Domain	Start	End	E-Value	Type
ANK	66	99	4.01e0	SMART
ANK	103	132	4.43e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141996

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152768

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a proto-oncogene candidate. It is identified by its translocation into the immunoglobulin alpha-locus in some cases of B-cell leukemia. The protein encoded by this gene contains seven ankyrin repeats, which are most closely related to those found in I kappa B proteins. This protein functions as a transcriptional co-activator that activates through its association with NF-kappa B homodimers. The expression of this gene can be induced by NF-kappa B, which forms a part of the autoregulatory loop that controls the nuclear residence of p50 NF-kappa B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice lacking functional copies of this gene exhibit defects of the immune system including disruption of the humoral immune response and abnormal spleen and Peyer's patch organogenesis. Mutant mice show increased susceptibility to pathogens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	T	A	12: 55,304,332	I142N	possibly damaging	Het
1110038F14Rik	CGGG	CGGGGGG	15: 76,949,663		probably benign	Het
Abca17	A	T	17: 24,267,716	C1446S	probably damaging	Het
Asb16	C	A	11: 102,276,756	A316E	possibly damaging	Het
Axdnd1	C	T	1: 156,376,544	V384I	possibly damaging	Het
BC024139	A	T	15: 76,125,261	L207*	probably null	Het
Cachd1	T	C	4: 100,777,358	V77A	probably benign	Het
Cd101	C	T	3: 101,029,448		probably null	Het
Cela1	T	C	15: 100,685,167	N64S	probably benign	Het
Cep128	T	C	12: 91,289,598	D366G	probably benign	Het
Col12a1	A	G	9: 79,697,541	V675A	probably benign	Het
Copg1	A	G	6: 87,893,818	Y201C	probably damaging	Het
Cyp24a1	T	C	2: 170,487,917	R372G	probably benign	Het
Dcaf1	A	C	9: 106,851,962	I567L	probably benign	Het
Dcn	A	G	10: 97,506,674	D164G	probably benign	Het
Dnase2a	T	A	8: 84,909,322	H113Q	probably benign	Het
Espl1	T	C	15: 102,299,013	V304A	probably benign	Het
Fam193a	A	G	5: 34,443,372	D315G	possibly damaging	Het
Fkbp8	T	A	8: 70,531,035		probably null	Het
Foxp4	T	A	17: 47,877,959	T321S	probably null	Het
Fut10	A	G	8: 31,236,300	N361S	probably damaging	Het
Gm13762	A	G	2: 88,973,138	V251A	probably benign	Het
Gyg	A	T	3: 20,151,122	V94D	probably damaging	Het
Has2	T	C	15: 56,668,578	K247R	probably damaging	Het
Helz2	G	T	2: 181,232,085	D2205E	probably benign	Het
Hps6	T	A	19: 46,004,970	S449T	probably benign	Het
Ints10	T	C	8: 68,794,671	Y64H	probably damaging	Het
Kalrn	T	C	16: 34,356,961	H278R	probably damaging	Het
Klhdc8a	T	C	1: 132,303,810	V280A	possibly damaging	Het
Klk1b5	A	G	7: 44,220,125	M210V	probably benign	Het
Kmt2c	G	A	5: 25,373,436	A614V	probably benign	Het
Lck	T	A	4: 129,558,086	I45F	probably benign	Het
Lin7a	A	C	10: 107,412,059	E75A	probably damaging	Het
Lrp1	A	T	10: 127,578,673	C1070S	probably damaging	Het
Mapk8ip3	G	T	17: 24,914,583	N289K	probably benign	Het
Mbtps1	T	C	8: 119,522,493	D686G	probably benign	Het
Mknk1	T	A	4: 115,873,231	C178*	probably null	Het
Mtmr6	A	G	14: 60,296,735	N474S	probably damaging	Het
Mvb12b	A	G	2: 33,840,157		probably null	Het
Myh6	T	C	14: 54,944,674	K1759R	probably damaging	Het
Nfatc1	T	C	18: 80,635,531	K881E	possibly damaging	Het
Nlrp10	A	G	7: 108,927,041	F30S	probably damaging	Het
Nop14	G	T	5: 34,650,328	A430E	possibly damaging	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Olfr1212	A	G	2: 88,958,867	I134V	probably damaging	Het
Olfr347	A	T	2: 36,734,842	I174F	probably damaging	Het
Olfr775	A	G	10: 129,250,594	E20G	probably benign	Het
Olfr794	A	T	10: 129,571,348	Q231L	probably damaging	Het
Olfr829	A	T	9: 18,857,486	Y287F	possibly damaging	Het
Osbpl7	C	A	11: 97,059,128	S378R	probably damaging	Het
Otof	A	T	5: 30,371,723	Y1775*	probably null	Het
Parp16	T	C	9: 65,215,594	S46P	possibly damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pi16	A	T	17: 29,319,387	Q58L	possibly damaging	Het
Pld3	C	A	7: 27,539,452	M190I	probably benign	Het
Plscr4	T	G	9: 92,490,046	I290S	probably damaging	Het
Ppip5k2	T	C	1: 97,723,806	D928G	possibly damaging	Het
Ppp1r13l	T	A	7: 19,368,611	L15Q	probably damaging	Het
Ptpn14	C	A	1: 189,839,502	S263R	possibly damaging	Het
Sema7a	G	A	9: 57,954,899	V178I	possibly damaging	Het
Sesn2	A	T	4: 132,497,070	Y342*	probably null	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Sltm	A	G	9: 70,543,032	N38S	possibly damaging	Het
Smg1	T	C	7: 118,154,622		probably benign	Het
Spsb1	A	T	4: 149,906,910	V67E	probably damaging	Het
Suox	A	G	10: 128,670,539	V540A	possibly damaging	Het
Tbc1d12	T	A	19: 38,911,085	I483N	probably damaging	Het
Tbcb	A	T	7: 30,224,499	D198E	possibly damaging	Het
Tbce	T	C	13: 14,019,709	K122E	probably benign	Het
Tcap	T	A	11: 98,384,379	L113H	probably damaging	Het
Thsd7a	A	T	6: 12,321,041	I1545N	probably damaging	Het
Tmed10	T	C	12: 85,374,503	T55A	possibly damaging	Het
Tmem268	T	A	4: 63,579,943	V200D	probably damaging	Het
Tmem45b	A	C	9: 31,431,355	I50M	probably damaging	Het
Trp53bp2	T	C	1: 182,458,903	W1103R	probably damaging	Het
Ttn	C	T	2: 76,764,033	V20524M	probably damaging	Het
Ulk2	A	T	11: 61,812,738	N379K	probably benign	Het
Vmn1r59	A	G	7: 5,454,554	V69A	probably benign	Het
Vmn2r10	A	T	5: 109,001,995	Y394*	probably null	Het
Zfp212	T	C	6: 47,931,541	S485P	probably benign	Het
Zfp512b	A	T	2: 181,585,735	C776S	probably damaging	Het
Zfp518b	A	G	5: 38,671,741	Y974H	probably damaging	Het

Other mutations in Bcl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01510:Bcl3	APN	7	19809614	missense	probably damaging	1.00
IGL01669:Bcl3	APN	7	19812491	nonsense	probably null
IGL03024:Bcl3	APN	7	19809134	splice site	probably benign
memorial	UTSW	7	19812484	missense	probably damaging	1.00
sunrise	UTSW	7	19811580	nonsense	probably null
sunrise2	UTSW	7	19809634	nonsense	probably null
R0124:Bcl3	UTSW	7	19809651	missense	probably damaging	1.00
R0136:Bcl3	UTSW	7	19809569	missense	probably damaging	1.00
R0554:Bcl3	UTSW	7	19820066	missense	probably benign	0.26
R2571:Bcl3	UTSW	7	19809527	missense	probably damaging	1.00
R4355:Bcl3	UTSW	7	19811580	nonsense	probably null
R4597:Bcl3	UTSW	7	19812503	missense	probably damaging	0.97
R4993:Bcl3	UTSW	7	19820177	missense	probably benign	0.00
R5587:Bcl3	UTSW	7	19809634	nonsense	probably null
R6232:Bcl3	UTSW	7	19812484	missense	probably damaging	1.00
R7439:Bcl3	UTSW	7	19822611	missense	probably benign
R7565:Bcl3	UTSW	7	19812494	missense	probably damaging	1.00
RF022:Bcl3	UTSW	7	19809041	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTGTTACCTTGCCGGCCTAAG -3'
(R):5'- TTTGACACAGCCCCATGTC -3'

Sequencing Primer
(F):5'- TTGCCGGCCTAAGCTCACTG -3'
(R):5'- CCATGTCCAGAATCATTTCAGG -3'

Posted On

2014-06-23