Incidental Mutation 'R1845:Fkbp8'
ID 207650
Institutional Source Beutler Lab
Gene Symbol Fkbp8
Ensembl Gene ENSMUSG00000019428
Gene Name FK506 binding protein 8
Synonyms 38kDa, Fkbp38
MMRRC Submission 039870-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1845 (G1)
Quality Score 185
Status Not validated
Chromosome 8
Chromosomal Location 70527724-70535328 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 70531035 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075491] [ENSMUST00000117580] [ENSMUST00000119353] [ENSMUST00000119425] [ENSMUST00000119698] [ENSMUST00000132867] [ENSMUST00000134893] [ENSMUST00000138260]
AlphaFold O35465
Predicted Effect probably benign
Transcript: ENSMUST00000075491
AA Change: S120T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000074935
Gene: ENSMUSG00000019428
AA Change: S120T

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
Pfam:FKBP_C 103 192 1.4e-16 PFAM
Blast:TPR 212 245 2e-12 BLAST
low complexity region 253 259 N/A INTRINSIC
Pfam:TPR_1 263 296 5.4e-7 PFAM
Pfam:TPR_2 263 296 3.8e-5 PFAM
Pfam:TPR_16 267 331 3e-11 PFAM
Pfam:TPR_9 270 344 1.3e-7 PFAM
Pfam:TPR_19 273 340 1.6e-8 PFAM
Pfam:TPR_1 297 330 5.4e-8 PFAM
Pfam:TPR_2 297 330 1.3e-7 PFAM
Pfam:TPR_8 297 330 9e-7 PFAM
Pfam:TPR_14 297 340 2.1e-7 PFAM
transmembrane domain 381 400 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117580
SMART Domains Protein: ENSMUSP00000112561
Gene: ENSMUSG00000055553

DomainStartEndE-ValueType
Pfam:KxDL 12 99 5.1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119353
AA Change: S120T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112527
Gene: ENSMUSG00000019428
AA Change: S120T

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
Pfam:FKBP_C 103 191 1.3e-15 PFAM
Pfam:TPR_11 209 293 3.4e-9 PFAM
Pfam:TPR_1 262 295 6.5e-7 PFAM
Pfam:TPR_2 262 295 3.9e-5 PFAM
Pfam:TPR_16 266 330 1.4e-11 PFAM
Pfam:TPR_9 269 343 1.5e-7 PFAM
Pfam:TPR_19 272 339 8.6e-9 PFAM
Pfam:TPR_11 294 358 2.6e-9 PFAM
Pfam:TPR_1 296 329 6.6e-8 PFAM
Pfam:TPR_2 296 329 1.3e-7 PFAM
Pfam:TPR_8 296 330 5.5e-7 PFAM
transmembrane domain 380 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119425
SMART Domains Protein: ENSMUSP00000113528
Gene: ENSMUSG00000019428

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119698
AA Change: S120T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114069
Gene: ENSMUSG00000019428
AA Change: S120T

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
Pfam:FKBP_C 103 192 6.4e-16 PFAM
Pfam:TPR_11 210 294 3.4e-9 PFAM
Pfam:TPR_1 263 296 6.5e-7 PFAM
Pfam:TPR_2 263 296 3.9e-5 PFAM
Pfam:TPR_16 267 331 1.4e-11 PFAM
Pfam:TPR_9 270 344 1.5e-7 PFAM
Pfam:TPR_19 273 340 8.6e-9 PFAM
Pfam:TPR_11 295 359 2.6e-9 PFAM
Pfam:TPR_1 297 330 6.6e-8 PFAM
Pfam:TPR_2 297 330 1.3e-7 PFAM
Pfam:TPR_8 297 331 5.6e-7 PFAM
transmembrane domain 381 400 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128513
Predicted Effect probably null
Transcript: ENSMUST00000132867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134299
Predicted Effect probably benign
Transcript: ENSMUST00000134893
Predicted Effect probably null
Transcript: ENSMUST00000138260
SMART Domains Protein: ENSMUSP00000123438
Gene: ENSMUSG00000055553

DomainStartEndE-ValueType
Pfam:KxDL 12 99 9.2e-40 PFAM
UBQ 105 176 2.14e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144766
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. Unlike the other members of the family, this encoded protein does not seem to have PPIase/rotamase activity. It may have a role in neurons associated with memory function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality, ventralization of neural cell fates, caudal neural tube dilation, and small eyes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,304,332 I142N possibly damaging Het
1110038F14Rik CGGG CGGGGGG 15: 76,949,663 probably benign Het
Abca17 A T 17: 24,267,716 C1446S probably damaging Het
Asb16 C A 11: 102,276,756 A316E possibly damaging Het
Axdnd1 C T 1: 156,376,544 V384I possibly damaging Het
BC024139 A T 15: 76,125,261 L207* probably null Het
Bcl3 T G 7: 19,809,627 S305R probably damaging Het
Cachd1 T C 4: 100,777,358 V77A probably benign Het
Cd101 C T 3: 101,029,448 probably null Het
Cela1 T C 15: 100,685,167 N64S probably benign Het
Cep128 T C 12: 91,289,598 D366G probably benign Het
Col12a1 A G 9: 79,697,541 V675A probably benign Het
Copg1 A G 6: 87,893,818 Y201C probably damaging Het
Cyp24a1 T C 2: 170,487,917 R372G probably benign Het
Dcaf1 A C 9: 106,851,962 I567L probably benign Het
Dcn A G 10: 97,506,674 D164G probably benign Het
Dnase2a T A 8: 84,909,322 H113Q probably benign Het
Espl1 T C 15: 102,299,013 V304A probably benign Het
Fam193a A G 5: 34,443,372 D315G possibly damaging Het
Foxp4 T A 17: 47,877,959 T321S probably null Het
Fut10 A G 8: 31,236,300 N361S probably damaging Het
Gm13762 A G 2: 88,973,138 V251A probably benign Het
Gyg A T 3: 20,151,122 V94D probably damaging Het
Has2 T C 15: 56,668,578 K247R probably damaging Het
Helz2 G T 2: 181,232,085 D2205E probably benign Het
Hps6 T A 19: 46,004,970 S449T probably benign Het
Ints10 T C 8: 68,794,671 Y64H probably damaging Het
Kalrn T C 16: 34,356,961 H278R probably damaging Het
Klhdc8a T C 1: 132,303,810 V280A possibly damaging Het
Klk1b5 A G 7: 44,220,125 M210V probably benign Het
Kmt2c G A 5: 25,373,436 A614V probably benign Het
Lck T A 4: 129,558,086 I45F probably benign Het
Lin7a A C 10: 107,412,059 E75A probably damaging Het
Lrp1 A T 10: 127,578,673 C1070S probably damaging Het
Mapk8ip3 G T 17: 24,914,583 N289K probably benign Het
Mbtps1 T C 8: 119,522,493 D686G probably benign Het
Mknk1 T A 4: 115,873,231 C178* probably null Het
Mtmr6 A G 14: 60,296,735 N474S probably damaging Het
Mvb12b A G 2: 33,840,157 probably null Het
Myh6 T C 14: 54,944,674 K1759R probably damaging Het
Nfatc1 T C 18: 80,635,531 K881E possibly damaging Het
Nlrp10 A G 7: 108,927,041 F30S probably damaging Het
Nop14 G T 5: 34,650,328 A430E possibly damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1212 A G 2: 88,958,867 I134V probably damaging Het
Olfr347 A T 2: 36,734,842 I174F probably damaging Het
Olfr775 A G 10: 129,250,594 E20G probably benign Het
Olfr794 A T 10: 129,571,348 Q231L probably damaging Het
Olfr829 A T 9: 18,857,486 Y287F possibly damaging Het
Osbpl7 C A 11: 97,059,128 S378R probably damaging Het
Otof A T 5: 30,371,723 Y1775* probably null Het
Parp16 T C 9: 65,215,594 S46P possibly damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pi16 A T 17: 29,319,387 Q58L possibly damaging Het
Pld3 C A 7: 27,539,452 M190I probably benign Het
Plscr4 T G 9: 92,490,046 I290S probably damaging Het
Ppip5k2 T C 1: 97,723,806 D928G possibly damaging Het
Ppp1r13l T A 7: 19,368,611 L15Q probably damaging Het
Ptpn14 C A 1: 189,839,502 S263R possibly damaging Het
Sema7a G A 9: 57,954,899 V178I possibly damaging Het
Sesn2 A T 4: 132,497,070 Y342* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sltm A G 9: 70,543,032 N38S possibly damaging Het
Smg1 T C 7: 118,154,622 probably benign Het
Spsb1 A T 4: 149,906,910 V67E probably damaging Het
Suox A G 10: 128,670,539 V540A possibly damaging Het
Tbc1d12 T A 19: 38,911,085 I483N probably damaging Het
Tbcb A T 7: 30,224,499 D198E possibly damaging Het
Tbce T C 13: 14,019,709 K122E probably benign Het
Tcap T A 11: 98,384,379 L113H probably damaging Het
Thsd7a A T 6: 12,321,041 I1545N probably damaging Het
Tmed10 T C 12: 85,374,503 T55A possibly damaging Het
Tmem268 T A 4: 63,579,943 V200D probably damaging Het
Tmem45b A C 9: 31,431,355 I50M probably damaging Het
Trp53bp2 T C 1: 182,458,903 W1103R probably damaging Het
Ttn C T 2: 76,764,033 V20524M probably damaging Het
Ulk2 A T 11: 61,812,738 N379K probably benign Het
Vmn1r59 A G 7: 5,454,554 V69A probably benign Het
Vmn2r10 A T 5: 109,001,995 Y394* probably null Het
Zfp212 T C 6: 47,931,541 S485P probably benign Het
Zfp512b A T 2: 181,585,735 C776S probably damaging Het
Zfp518b A G 5: 38,671,741 Y974H probably damaging Het
Other mutations in Fkbp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Fkbp8 APN 8 70534561 missense probably damaging 1.00
IGL01832:Fkbp8 APN 8 70531545 missense probably benign 0.24
R0738:Fkbp8 UTSW 8 70529670 missense probably damaging 1.00
R1631:Fkbp8 UTSW 8 70531632 missense probably damaging 1.00
R3951:Fkbp8 UTSW 8 70532661 missense probably damaging 1.00
R3953:Fkbp8 UTSW 8 70534867 missense probably damaging 0.97
R3956:Fkbp8 UTSW 8 70534867 missense probably damaging 0.97
R3957:Fkbp8 UTSW 8 70534867 missense probably damaging 0.97
R4965:Fkbp8 UTSW 8 70531523 critical splice acceptor site probably null
R6655:Fkbp8 UTSW 8 70532670 missense probably damaging 1.00
R7081:Fkbp8 UTSW 8 70530994 missense probably benign 0.05
R8454:Fkbp8 UTSW 8 70531763 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATGGCCACTGCATCTGAAGG -3'
(R):5'- GTACTTGGAGTCAGCGGTAAC -3'

Sequencing Primer
(F):5'- CACTGCATCTGAAGGTGGCTTG -3'
(R):5'- AGCGGTAACCATGGCTGTCTC -3'
Posted On 2014-06-23