Incidental Mutation 'R1845:Dnase2a'
ID207651
Institutional Source Beutler Lab
Gene Symbol Dnase2a
Ensembl Gene ENSMUSG00000003812
Gene Namedeoxyribonuclease II alpha
Synonyms
MMRRC Submission 039870-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1845 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location84908560-84922915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84909322 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 113 (H113Q)
Ref Sequence ENSEMBL: ENSMUSP00000117198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003910] [ENSMUST00000067060] [ENSMUST00000109741] [ENSMUST00000109744] [ENSMUST00000119820] [ENSMUST00000134569] [ENSMUST00000145292]
Predicted Effect probably benign
Transcript: ENSMUST00000003910
AA Change: H113Q

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000003910
Gene: ENSMUSG00000003812
AA Change: H113Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DNase_II 21 349 5.8e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067060
SMART Domains Protein: ENSMUSP00000064366
Gene: ENSMUSG00000054191

DomainStartEndE-ValueType
Pfam:EKLF_TAD1 40 66 9e-23 PFAM
Pfam:EKLF_TAD2 78 103 4.9e-16 PFAM
low complexity region 153 180 N/A INTRINSIC
low complexity region 197 212 N/A INTRINSIC
low complexity region 235 246 N/A INTRINSIC
ZnF_C2H2 293 317 2.2e-2 SMART
ZnF_C2H2 323 347 7.49e-5 SMART
ZnF_C2H2 353 375 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109741
SMART Domains Protein: ENSMUSP00000105363
Gene: ENSMUSG00000053693

DomainStartEndE-ValueType
Pfam:DUF1908 61 337 1.4e-136 PFAM
S_TKc 376 649 4.07e-97 SMART
S_TK_X 650 710 6.23e-2 SMART
low complexity region 820 836 N/A INTRINSIC
low complexity region 863 878 N/A INTRINSIC
low complexity region 933 961 N/A INTRINSIC
PDZ 977 1057 3.49e-14 SMART
low complexity region 1104 1132 N/A INTRINSIC
low complexity region 1149 1174 N/A INTRINSIC
low complexity region 1212 1224 N/A INTRINSIC
low complexity region 1243 1252 N/A INTRINSIC
low complexity region 1479 1492 N/A INTRINSIC
low complexity region 1519 1535 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109744
AA Change: H92Q

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105366
Gene: ENSMUSG00000003812
AA Change: H92Q

DomainStartEndE-ValueType
Pfam:DNase_II 9 328 4.8e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119820
SMART Domains Protein: ENSMUSP00000113547
Gene: ENSMUSG00000053693

DomainStartEndE-ValueType
Pfam:DUF1908 61 338 5.1e-148 PFAM
S_TKc 376 644 2.79e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128400
Predicted Effect probably benign
Transcript: ENSMUST00000134569
AA Change: H113Q

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000117198
Gene: ENSMUSG00000003812
AA Change: H113Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DNase_II 20 119 6.6e-32 PFAM
Pfam:DNase_II 115 182 4.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135219
Predicted Effect probably benign
Transcript: ENSMUST00000145292
SMART Domains Protein: ENSMUSP00000138203
Gene: ENSMUSG00000003812

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DNase_II 20 97 2.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155942
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNase family. The protein, located in the lysosome, hydrolyzes DNA under acidic conditions and mediates the breakdown of DNA during erythropoiesis and apoptosis. Two codominant alleles have been characterized, DNASE2*L (low activity) and DNASE2*H (high activity), that differ at one nucleotide in the promoter region. The DNASE2*H allele is represented in this record. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted mutations of this gene result in perinatal death, anemia, and impaired definitive erythropoiesis in the fetal liver. Homozygotes for one null mutation display diaphragm abnormalities and asphyxiation, as well as a specific defect in the phagocytic phase of apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,304,332 I142N possibly damaging Het
1110038F14Rik CGGG CGGGGGG 15: 76,949,663 probably benign Het
Abca17 A T 17: 24,267,716 C1446S probably damaging Het
Asb16 C A 11: 102,276,756 A316E possibly damaging Het
Axdnd1 C T 1: 156,376,544 V384I possibly damaging Het
BC024139 A T 15: 76,125,261 L207* probably null Het
Bcl3 T G 7: 19,809,627 S305R probably damaging Het
Cachd1 T C 4: 100,777,358 V77A probably benign Het
Cd101 C T 3: 101,029,448 probably null Het
Cela1 T C 15: 100,685,167 N64S probably benign Het
Cep128 T C 12: 91,289,598 D366G probably benign Het
Col12a1 A G 9: 79,697,541 V675A probably benign Het
Copg1 A G 6: 87,893,818 Y201C probably damaging Het
Cyp24a1 T C 2: 170,487,917 R372G probably benign Het
Dcaf1 A C 9: 106,851,962 I567L probably benign Het
Dcn A G 10: 97,506,674 D164G probably benign Het
Espl1 T C 15: 102,299,013 V304A probably benign Het
Fam193a A G 5: 34,443,372 D315G possibly damaging Het
Fkbp8 T A 8: 70,531,035 probably null Het
Foxp4 T A 17: 47,877,959 T321S probably null Het
Fut10 A G 8: 31,236,300 N361S probably damaging Het
Gm13762 A G 2: 88,973,138 V251A probably benign Het
Gyg A T 3: 20,151,122 V94D probably damaging Het
Has2 T C 15: 56,668,578 K247R probably damaging Het
Helz2 G T 2: 181,232,085 D2205E probably benign Het
Hps6 T A 19: 46,004,970 S449T probably benign Het
Ints10 T C 8: 68,794,671 Y64H probably damaging Het
Kalrn T C 16: 34,356,961 H278R probably damaging Het
Klhdc8a T C 1: 132,303,810 V280A possibly damaging Het
Klk1b5 A G 7: 44,220,125 M210V probably benign Het
Kmt2c G A 5: 25,373,436 A614V probably benign Het
Lck T A 4: 129,558,086 I45F probably benign Het
Lin7a A C 10: 107,412,059 E75A probably damaging Het
Lrp1 A T 10: 127,578,673 C1070S probably damaging Het
Mapk8ip3 G T 17: 24,914,583 N289K probably benign Het
Mbtps1 T C 8: 119,522,493 D686G probably benign Het
Mknk1 T A 4: 115,873,231 C178* probably null Het
Mtmr6 A G 14: 60,296,735 N474S probably damaging Het
Mvb12b A G 2: 33,840,157 probably null Het
Myh6 T C 14: 54,944,674 K1759R probably damaging Het
Nfatc1 T C 18: 80,635,531 K881E possibly damaging Het
Nlrp10 A G 7: 108,927,041 F30S probably damaging Het
Nop14 G T 5: 34,650,328 A430E possibly damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1212 A G 2: 88,958,867 I134V probably damaging Het
Olfr347 A T 2: 36,734,842 I174F probably damaging Het
Olfr775 A G 10: 129,250,594 E20G probably benign Het
Olfr794 A T 10: 129,571,348 Q231L probably damaging Het
Olfr829 A T 9: 18,857,486 Y287F possibly damaging Het
Osbpl7 C A 11: 97,059,128 S378R probably damaging Het
Otof A T 5: 30,371,723 Y1775* probably null Het
Parp16 T C 9: 65,215,594 S46P possibly damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pi16 A T 17: 29,319,387 Q58L possibly damaging Het
Pld3 C A 7: 27,539,452 M190I probably benign Het
Plscr4 T G 9: 92,490,046 I290S probably damaging Het
Ppip5k2 T C 1: 97,723,806 D928G possibly damaging Het
Ppp1r13l T A 7: 19,368,611 L15Q probably damaging Het
Ptpn14 C A 1: 189,839,502 S263R possibly damaging Het
Sema7a G A 9: 57,954,899 V178I possibly damaging Het
Sesn2 A T 4: 132,497,070 Y342* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sltm A G 9: 70,543,032 N38S possibly damaging Het
Smg1 T C 7: 118,154,622 probably benign Het
Spsb1 A T 4: 149,906,910 V67E probably damaging Het
Suox A G 10: 128,670,539 V540A possibly damaging Het
Tbc1d12 T A 19: 38,911,085 I483N probably damaging Het
Tbcb A T 7: 30,224,499 D198E possibly damaging Het
Tbce T C 13: 14,019,709 K122E probably benign Het
Tcap T A 11: 98,384,379 L113H probably damaging Het
Thsd7a A T 6: 12,321,041 I1545N probably damaging Het
Tmed10 T C 12: 85,374,503 T55A possibly damaging Het
Tmem268 T A 4: 63,579,943 V200D probably damaging Het
Tmem45b A C 9: 31,431,355 I50M probably damaging Het
Trp53bp2 T C 1: 182,458,903 W1103R probably damaging Het
Ttn C T 2: 76,764,033 V20524M probably damaging Het
Ulk2 A T 11: 61,812,738 N379K probably benign Het
Vmn1r59 A G 7: 5,454,554 V69A probably benign Het
Vmn2r10 A T 5: 109,001,995 Y394* probably null Het
Zfp212 T C 6: 47,931,541 S485P probably benign Het
Zfp512b A T 2: 181,585,735 C776S probably damaging Het
Zfp518b A G 5: 38,671,741 Y974H probably damaging Het
Other mutations in Dnase2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0211:Dnase2a UTSW 8 84908788 unclassified probably benign
R0211:Dnase2a UTSW 8 84908788 unclassified probably benign
R0396:Dnase2a UTSW 8 84909763 splice site probably benign
R1870:Dnase2a UTSW 8 84908763 start gained probably benign
R1939:Dnase2a UTSW 8 84910895 missense possibly damaging 0.83
R2113:Dnase2a UTSW 8 84910871 missense probably damaging 0.99
R2442:Dnase2a UTSW 8 84908993 missense probably damaging 1.00
R4815:Dnase2a UTSW 8 84909877 missense probably benign 0.12
R4913:Dnase2a UTSW 8 84908848 missense probably damaging 1.00
R4922:Dnase2a UTSW 8 84908996 unclassified probably null
R5183:Dnase2a UTSW 8 84909578 intron probably benign
R6239:Dnase2a UTSW 8 84908879 splice site probably null
R6951:Dnase2a UTSW 8 84909625 missense possibly damaging 0.93
R7215:Dnase2a UTSW 8 84909770 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TACATCAACAGCTCGGAGGGAG -3'
(R):5'- CAAGCTAGCTCACCTGCAAG -3'

Sequencing Primer
(F):5'- TTGCAGCCATTGTACCGAAAG -3'
(R):5'- CTGCAAGCAGGTACGGG -3'
Posted On2014-06-23