Mutagenetix > Incidental Mutation

Incidental Mutation 'R1845:Lrp1'

207664

Institutional Source

Beutler Lab

Gene Symbol

Lrp1

Ensembl Gene

ENSMUSG00000040249

Gene Name

low density lipoprotein receptor-related protein 1

Synonyms

A2mr, b2b1554Clo, CD91

MMRRC Submission

039870-MU

Accession Numbers

NCBI RefSeq: NM_008512.2; MGI:96828

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1845 (G1)

Quality Score

130

Status

Not validated

Chromosome

Chromosomal Location

127538161-127621148 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 127578673 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 1070 (C1070S)

Ref Sequence

ENSEMBL: ENSMUSP00000044004 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049149]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000049149
AA Change: C1070S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000044004
Gene: ENSMUSG00000040249
AA Change: C1070S

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
LDLa	27	67	1.03e-15	SMART
LDLa	72	111	1.04e-11	SMART
EGF	115	150	8.78e-2	SMART
EGF_CA	151	190	4.49e-8	SMART
low complexity region	222	232	N/A	INTRINSIC
LY	273	315	7.07e-6	SMART
LY	316	359	2.31e-10	SMART
LY	360	402	8.3e-12	SMART
EGF	478	521	9.93e-1	SMART
LY	552	594	8.84e-7	SMART
LY	595	638	6.54e-10	SMART
LY	641	690	2.5e-15	SMART
LY	691	734	1.06e-9	SMART
EGF	807	844	1.38e1	SMART
LDLa	854	893	3.39e-16	SMART
LDLa	895	934	1.73e-13	SMART
LDLa	936	974	4.47e-16	SMART
LDLa	976	1014	2.53e-15	SMART
LDLa	1015	1054	2.95e-16	SMART
LDLa	1062	1100	3.24e-13	SMART
LDLa	1104	1143	2.97e-12	SMART
LDLa	1145	1185	1.24e-9	SMART
EGF	1185	1223	4.97e-1	SMART
EGF	1227	1263	6.02e0	SMART
LY	1290	1332	3.76e-1	SMART
LY	1337	1379	8.56e-14	SMART
LY	1380	1424	8.43e-13	SMART
LY	1425	1469	3.05e-10	SMART
LY	1471	1513	3.88e-3	SMART
EGF	1540	1580	1.85e0	SMART
LY	1606	1650	2.83e-5	SMART
LY	1651	1695	2.01e-10	SMART
LY	1698	1735	1.87e-5	SMART
LY	1736	1777	3.54e-6	SMART
LY	1778	1820	4.17e1	SMART
EGF	1850	1888	1.24e-1	SMART
LY	1915	1957	3.2e-4	SMART
LY	1958	2000	2.33e-15	SMART
LY	2001	2044	7.45e-14	SMART
LY	2045	2087	3.87e-12	SMART
LY	2089	2131	1.37e0	SMART
EGF	2159	2196	1.66e1	SMART
LY	2276	2318	5.57e-4	SMART
LY	2324	2369	3.3e-6	SMART
LY	2370	2412	3.93e-13	SMART
LY	2413	2454	3.62e-3	SMART
EGF_like	2482	2519	3.16e1	SMART
LDLa	2524	2564	3.31e-10	SMART
LDLa	2566	2603	7.21e-11	SMART
LDLa	2605	2642	1.09e-10	SMART
LDLa	2660	2691	6.05e-4	SMART
LDLa	2696	2733	2.49e-14	SMART
LDLa	2734	2772	4.65e-14	SMART
LDLa	2774	2815	3.92e-12	SMART
LDLa	2818	2856	1.51e-13	SMART
LDLa	2858	2900	1.93e-11	SMART
LDLa	2904	2942	1.73e-13	SMART
EGF_CA	2941	2982	6.16e-6	SMART
EGF_CA	2983	3023	2.66e-10	SMART
LY	3050	3094	6.64e-11	SMART
LY	3095	3137	7.17e-16	SMART
LY	3138	3181	4.28e-14	SMART
LY	3182	3224	8.11e-15	SMART
LY	3225	3265	1.44e-6	SMART
EGF	3294	3332	1.02e-2	SMART
LDLa	3334	3372	2.25e-12	SMART
LDLa	3374	3411	9.81e-13	SMART
LDLa	3413	3451	9.81e-13	SMART
LDLa	3453	3492	5.67e-18	SMART
LDLa	3494	3534	7.15e-15	SMART
LDLa	3536	3573	1.79e-15	SMART
EGF_like	3575	3611	4.83e1	SMART
LDLa	3575	3612	1.92e-15	SMART
LDLa	3613	3650	1.18e-15	SMART
LDLa	3654	3693	7.55e-14	SMART
LDLa	3695	3734	1.14e-8	SMART
LDLa	3741	3779	6.28e-11	SMART
EGF	3785	3824	1.06e1	SMART
EGF	3828	3862	1.51e0	SMART
LY	3893	3935	9.43e0	SMART
LY	3951	3993	1.23e-14	SMART
LY	3994	4037	2.98e-13	SMART
LY	4038	4080	4.28e-14	SMART
EGF	4151	4184	3.76e-1	SMART
low complexity region	4185	4198	N/A	INTRINSIC
EGF	4200	4233	3.82e-2	SMART
EGF	4236	4269	4.03e-1	SMART
EGF	4272	4305	5.2e-4	SMART
EGF	4308	4341	1.22e0	SMART
EGF_like	4344	4376	4.11e1	SMART
EGF	4377	4410	5.12e-3	SMART
transmembrane domain	4423	4445	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129877

Predicted Effect

probably benign
Transcript: ENSMUST00000133620

SMART Domains

Protein: ENSMUSP00000115305
Gene: ENSMUSG00000040249

Domain	Start	End	E-Value	Type
LDLa	4	42	8.94e-16	SMART
LDLa	60	98	1.41e-13	SMART

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.7%

Validation Efficiency

MGI Phenotype

Strain: 2178192
Lethality: E10-E13
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low-density lipoprotein receptor family of proteins. The encoded preproprotein is proteolytically processed by furin to generate 515 kDa and 85 kDa subunits that form the mature receptor (PMID: 8546712). This receptor is involved in several cellular processes, including intracellular signaling, lipid homeostasis, and clearance of apoptotic cells. In addition, the encoded protein is necessary for the alpha 2-macroglobulin-mediated clearance of secreted amyloid precursor protein and beta-amyloid, the main component of amyloid plaques found in Alzheimer patients. Expression of this gene decreases with age and has been found to be lower than controls in brain tissue from Alzheimer's disease patients. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit lethality during late organogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(42) : Targeted(9) Gene trapped(33)

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	T	A	12: 55,304,332	I142N	possibly damaging	Het
1110038F14Rik	CGGG	CGGGGGG	15: 76,949,663		probably benign	Het
Abca17	A	T	17: 24,267,716	C1446S	probably damaging	Het
Asb16	C	A	11: 102,276,756	A316E	possibly damaging	Het
Axdnd1	C	T	1: 156,376,544	V384I	possibly damaging	Het
BC024139	A	T	15: 76,125,261	L207*	probably null	Het
Bcl3	T	G	7: 19,809,627	S305R	probably damaging	Het
Cachd1	T	C	4: 100,777,358	V77A	probably benign	Het
Cd101	C	T	3: 101,029,448		probably null	Het
Cela1	T	C	15: 100,685,167	N64S	probably benign	Het
Cep128	T	C	12: 91,289,598	D366G	probably benign	Het
Col12a1	A	G	9: 79,697,541	V675A	probably benign	Het
Copg1	A	G	6: 87,893,818	Y201C	probably damaging	Het
Cyp24a1	T	C	2: 170,487,917	R372G	probably benign	Het
Dcaf1	A	C	9: 106,851,962	I567L	probably benign	Het
Dcn	A	G	10: 97,506,674	D164G	probably benign	Het
Dnase2a	T	A	8: 84,909,322	H113Q	probably benign	Het
Espl1	T	C	15: 102,299,013	V304A	probably benign	Het
Fam193a	A	G	5: 34,443,372	D315G	possibly damaging	Het
Fkbp8	T	A	8: 70,531,035		probably null	Het
Foxp4	T	A	17: 47,877,959	T321S	probably null	Het
Fut10	A	G	8: 31,236,300	N361S	probably damaging	Het
Gm13762	A	G	2: 88,973,138	V251A	probably benign	Het
Gyg	A	T	3: 20,151,122	V94D	probably damaging	Het
Has2	T	C	15: 56,668,578	K247R	probably damaging	Het
Helz2	G	T	2: 181,232,085	D2205E	probably benign	Het
Hps6	T	A	19: 46,004,970	S449T	probably benign	Het
Ints10	T	C	8: 68,794,671	Y64H	probably damaging	Het
Kalrn	T	C	16: 34,356,961	H278R	probably damaging	Het
Klhdc8a	T	C	1: 132,303,810	V280A	possibly damaging	Het
Klk1b5	A	G	7: 44,220,125	M210V	probably benign	Het
Kmt2c	G	A	5: 25,373,436	A614V	probably benign	Het
Lck	T	A	4: 129,558,086	I45F	probably benign	Het
Lin7a	A	C	10: 107,412,059	E75A	probably damaging	Het
Mapk8ip3	G	T	17: 24,914,583	N289K	probably benign	Het
Mbtps1	T	C	8: 119,522,493	D686G	probably benign	Het
Mknk1	T	A	4: 115,873,231	C178*	probably null	Het
Mtmr6	A	G	14: 60,296,735	N474S	probably damaging	Het
Mvb12b	A	G	2: 33,840,157		probably null	Het
Myh6	T	C	14: 54,944,674	K1759R	probably damaging	Het
Nfatc1	T	C	18: 80,635,531	K881E	possibly damaging	Het
Nlrp10	A	G	7: 108,927,041	F30S	probably damaging	Het
Nop14	G	T	5: 34,650,328	A430E	possibly damaging	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Olfr1212	A	G	2: 88,958,867	I134V	probably damaging	Het
Olfr347	A	T	2: 36,734,842	I174F	probably damaging	Het
Olfr775	A	G	10: 129,250,594	E20G	probably benign	Het
Olfr794	A	T	10: 129,571,348	Q231L	probably damaging	Het
Olfr829	A	T	9: 18,857,486	Y287F	possibly damaging	Het
Osbpl7	C	A	11: 97,059,128	S378R	probably damaging	Het
Otof	A	T	5: 30,371,723	Y1775*	probably null	Het
Parp16	T	C	9: 65,215,594	S46P	possibly damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pi16	A	T	17: 29,319,387	Q58L	possibly damaging	Het
Pld3	C	A	7: 27,539,452	M190I	probably benign	Het
Plscr4	T	G	9: 92,490,046	I290S	probably damaging	Het
Ppip5k2	T	C	1: 97,723,806	D928G	possibly damaging	Het
Ppp1r13l	T	A	7: 19,368,611	L15Q	probably damaging	Het
Ptpn14	C	A	1: 189,839,502	S263R	possibly damaging	Het
Sema7a	G	A	9: 57,954,899	V178I	possibly damaging	Het
Sesn2	A	T	4: 132,497,070	Y342*	probably null	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Sltm	A	G	9: 70,543,032	N38S	possibly damaging	Het
Smg1	T	C	7: 118,154,622		probably benign	Het
Spsb1	A	T	4: 149,906,910	V67E	probably damaging	Het
Suox	A	G	10: 128,670,539	V540A	possibly damaging	Het
Tbc1d12	T	A	19: 38,911,085	I483N	probably damaging	Het
Tbcb	A	T	7: 30,224,499	D198E	possibly damaging	Het
Tbce	T	C	13: 14,019,709	K122E	probably benign	Het
Tcap	T	A	11: 98,384,379	L113H	probably damaging	Het
Thsd7a	A	T	6: 12,321,041	I1545N	probably damaging	Het
Tmed10	T	C	12: 85,374,503	T55A	possibly damaging	Het
Tmem268	T	A	4: 63,579,943	V200D	probably damaging	Het
Tmem45b	A	C	9: 31,431,355	I50M	probably damaging	Het
Trp53bp2	T	C	1: 182,458,903	W1103R	probably damaging	Het
Ttn	C	T	2: 76,764,033	V20524M	probably damaging	Het
Ulk2	A	T	11: 61,812,738	N379K	probably benign	Het
Vmn1r59	A	G	7: 5,454,554	V69A	probably benign	Het
Vmn2r10	A	T	5: 109,001,995	Y394*	probably null	Het
Zfp212	T	C	6: 47,931,541	S485P	probably benign	Het
Zfp512b	A	T	2: 181,585,735	C776S	probably damaging	Het
Zfp518b	A	G	5: 38,671,741	Y974H	probably damaging	Het

Other mutations in Lrp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00793:Lrp1	APN	10	127542205	missense	possibly damaging	0.89
IGL01065:Lrp1	APN	10	127575038	missense	probably benign	0.10
IGL01121:Lrp1	APN	10	127583853	nonsense	probably null
IGL01360:Lrp1	APN	10	127545820	missense	possibly damaging	0.93
IGL01402:Lrp1	APN	10	127595032	missense	probably damaging	1.00
IGL01404:Lrp1	APN	10	127595032	missense	probably damaging	1.00
IGL01411:Lrp1	APN	10	127581765	nonsense	probably null
IGL01469:Lrp1	APN	10	127584414	missense	probably damaging	1.00
IGL01552:Lrp1	APN	10	127588510	nonsense	probably null
IGL01682:Lrp1	APN	10	127574978	missense	probably benign	0.00
IGL01760:Lrp1	APN	10	127573501	missense	probably benign	0.00
IGL01918:Lrp1	APN	10	127554589	missense	probably damaging	0.99
IGL01989:Lrp1	APN	10	127578129	missense	probably damaging	1.00
IGL02105:Lrp1	APN	10	127544579	missense	probably damaging	1.00
IGL02158:Lrp1	APN	10	127554271	missense	probably benign	0.02
IGL02164:Lrp1	APN	10	127563667	missense	probably benign	0.39
IGL02337:Lrp1	APN	10	127576887	missense	possibly damaging	0.87
IGL02425:Lrp1	APN	10	127571887	critical splice donor site	probably null
IGL02493:Lrp1	APN	10	127581778	missense	probably damaging	0.99
IGL02563:Lrp1	APN	10	127551686	missense	probably damaging	1.00
IGL02590:Lrp1	APN	10	127552791	missense	probably damaging	1.00
IGL02624:Lrp1	APN	10	127572422	missense	probably damaging	0.98
IGL02625:Lrp1	APN	10	127574486	missense	probably damaging	1.00
IGL02825:Lrp1	APN	10	127542605	missense	probably damaging	1.00
IGL02880:Lrp1	APN	10	127540222	missense	probably benign	0.12
IGL02900:Lrp1	APN	10	127576647	splice site	probably benign
IGL02956:Lrp1	APN	10	127544559	missense	probably benign	0.00
IGL02974:Lrp1	APN	10	127555016	missense	probably damaging	0.99
IGL02983:Lrp1	APN	10	127550199	missense	probably damaging	1.00
IGL03002:Lrp1	APN	10	127589636	missense	probably damaging	1.00
IGL03091:Lrp1	APN	10	127559124	missense	probably benign	0.30
IGL03109:Lrp1	APN	10	127566645	missense	probably benign
IGL03194:Lrp1	APN	10	127568685	missense	probably damaging	1.00
IGL03232:Lrp1	APN	10	127539376	missense	probably damaging	1.00
calculus	UTSW	10	127558068	splice site	probably null
Delimiter	UTSW	10	127546862	missense	probably damaging	1.00
extremis	UTSW	10	127556988	missense	probably benign	0.00
Jockey	UTSW	10	127560136	missense	probably damaging	1.00
peripheral	UTSW	10	127610381	missense	probably damaging	1.00
tangential	UTSW	10	127593848	missense	probably damaging	0.99
P0015:Lrp1	UTSW	10	127566663	missense	probably damaging	0.99
PIT4519001:Lrp1	UTSW	10	127607974	missense	possibly damaging	0.91
PIT4520001:Lrp1	UTSW	10	127607974	missense	possibly damaging	0.91
R0004:Lrp1	UTSW	10	127541825	splice site	probably null
R0034:Lrp1	UTSW	10	127545651	missense	probably benign	0.42
R0091:Lrp1	UTSW	10	127540979	missense	probably damaging	1.00
R0098:Lrp1	UTSW	10	127552738	missense	probably benign
R0098:Lrp1	UTSW	10	127552738	missense	probably benign
R0143:Lrp1	UTSW	10	127593942	missense	probably damaging	1.00
R0372:Lrp1	UTSW	10	127592136	missense	probably damaging	1.00
R0379:Lrp1	UTSW	10	127594969	missense	probably damaging	1.00
R0445:Lrp1	UTSW	10	127590636	nonsense	probably null
R0529:Lrp1	UTSW	10	127541594	splice site	probably null
R0551:Lrp1	UTSW	10	127571958	missense	probably benign
R0570:Lrp1	UTSW	10	127555009	nonsense	probably null
R0600:Lrp1	UTSW	10	127567383	missense	probably benign	0.00
R0626:Lrp1	UTSW	10	127567364	missense	probably damaging	1.00
R0647:Lrp1	UTSW	10	127571477	missense	probably damaging	1.00
R0680:Lrp1	UTSW	10	127589661	missense	probably damaging	1.00
R0792:Lrp1	UTSW	10	127567364	missense	probably damaging	1.00
R0792:Lrp1	UTSW	10	127575286	missense	probably benign	0.04
R0848:Lrp1	UTSW	10	127553362	splice site	probably null
R0866:Lrp1	UTSW	10	127539278	missense	probably damaging	1.00
R0918:Lrp1	UTSW	10	127593965	missense	probably damaging	1.00
R1076:Lrp1	UTSW	10	127563797	splice site	probably benign
R1107:Lrp1	UTSW	10	127557435	missense	probably damaging	1.00
R1346:Lrp1	UTSW	10	127605866	missense	probably damaging	1.00
R1403:Lrp1	UTSW	10	127581891	critical splice acceptor site	probably null
R1403:Lrp1	UTSW	10	127581891	critical splice acceptor site	probably null
R1496:Lrp1	UTSW	10	127539011	missense	probably damaging	1.00
R1522:Lrp1	UTSW	10	127567364	missense	probably damaging	1.00
R1522:Lrp1	UTSW	10	127575286	missense	probably benign	0.04
R1525:Lrp1	UTSW	10	127539529	missense	probably damaging	1.00
R1539:Lrp1	UTSW	10	127584381	splice site	probably null
R1589:Lrp1	UTSW	10	127605606	missense	probably benign	0.00
R1591:Lrp1	UTSW	10	127605606	missense	probably benign	0.00
R1663:Lrp1	UTSW	10	127556921	missense	probably damaging	1.00
R1682:Lrp1	UTSW	10	127574332	missense	probably damaging	1.00
R1717:Lrp1	UTSW	10	127556269	missense	possibly damaging	0.59
R1717:Lrp1	UTSW	10	127563665	missense	probably damaging	1.00
R1758:Lrp1	UTSW	10	127588584	missense	possibly damaging	0.76
R1826:Lrp1	UTSW	10	127553707	missense	probably damaging	1.00
R1842:Lrp1	UTSW	10	127573468	missense	possibly damaging	0.93
R1844:Lrp1	UTSW	10	127595283	critical splice donor site	probably null
R1896:Lrp1	UTSW	10	127559998	missense	possibly damaging	0.64
R1952:Lrp1	UTSW	10	127567431	missense	probably damaging	1.00
R2009:Lrp1	UTSW	10	127544516	missense	probably damaging	1.00
R2015:Lrp1	UTSW	10	127540694	missense	probably benign	0.00
R2116:Lrp1	UTSW	10	127576493	nonsense	probably null
R2161:Lrp1	UTSW	10	127555738	missense	probably damaging	1.00
R2199:Lrp1	UTSW	10	127546840	missense	probably damaging	1.00
R2213:Lrp1	UTSW	10	127540702	missense	probably damaging	1.00
R2300:Lrp1	UTSW	10	127556915	nonsense	probably null
R2324:Lrp1	UTSW	10	127566586	missense	possibly damaging	0.92
R2849:Lrp1	UTSW	10	127542296	missense	probably damaging	1.00
R2926:Lrp1	UTSW	10	127588113	missense	probably damaging	0.98
R2993:Lrp1	UTSW	10	127610381	missense	probably damaging	1.00
R3522:Lrp1	UTSW	10	127553555	missense	probably damaging	1.00
R3702:Lrp1	UTSW	10	127595103	missense	probably damaging	1.00
R3789:Lrp1	UTSW	10	127571969	missense	possibly damaging	0.94
R3898:Lrp1	UTSW	10	127592100	nonsense	probably null
R3941:Lrp1	UTSW	10	127553396	missense	probably damaging	1.00
R3958:Lrp1	UTSW	10	127571958	missense	probably benign
R4369:Lrp1	UTSW	10	127550286	missense	possibly damaging	0.87
R4510:Lrp1	UTSW	10	127593848	missense	probably damaging	0.99
R4511:Lrp1	UTSW	10	127593848	missense	probably damaging	0.99
R4576:Lrp1	UTSW	10	127540188	small deletion	probably benign
R4583:Lrp1	UTSW	10	127541372	missense	probably benign	0.00
R4662:Lrp1	UTSW	10	127552185	nonsense	probably null
R4721:Lrp1	UTSW	10	127555059	missense	possibly damaging	0.58
R4728:Lrp1	UTSW	10	127563737	missense	probably damaging	1.00
R4745:Lrp1	UTSW	10	127549944	missense	probably benign	0.20
R4785:Lrp1	UTSW	10	127558133	missense	probably benign	0.12
R4841:Lrp1	UTSW	10	127583936	missense	probably damaging	1.00
R4842:Lrp1	UTSW	10	127583936	missense	probably damaging	1.00
R4855:Lrp1	UTSW	10	127610442	missense	probably benign	0.03
R4860:Lrp1	UTSW	10	127553824	missense	probably damaging	1.00
R4860:Lrp1	UTSW	10	127553824	missense	probably damaging	1.00
R4891:Lrp1	UTSW	10	127541752	missense	probably damaging	1.00
R4925:Lrp1	UTSW	10	127575075	nonsense	probably null
R4970:Lrp1	UTSW	10	127539520	missense	probably benign	0.11
R4999:Lrp1	UTSW	10	127553779	missense	probably damaging	1.00
R5044:Lrp1	UTSW	10	127567495	missense	probably damaging	1.00
R5127:Lrp1	UTSW	10	127539634	intron	probably benign
R5188:Lrp1	UTSW	10	127607952	missense	probably damaging	1.00
R5218:Lrp1	UTSW	10	127548619	missense	probably damaging	1.00
R5225:Lrp1	UTSW	10	127556096	missense	probably benign	0.04
R5291:Lrp1	UTSW	10	127593878	missense	probably damaging	1.00
R5386:Lrp1	UTSW	10	127592114	missense	probably damaging	1.00
R5395:Lrp1	UTSW	10	127595297	missense	probably damaging	1.00
R5413:Lrp1	UTSW	10	127588067	critical splice donor site	probably null
R5430:Lrp1	UTSW	10	127541061	missense	probably damaging	0.99
R5499:Lrp1	UTSW	10	127572944	missense	possibly damaging	0.58
R5526:Lrp1	UTSW	10	127555724	missense	probably benign	0.37
R5580:Lrp1	UTSW	10	127588520	missense	probably benign
R5583:Lrp1	UTSW	10	127588463	missense	probably benign	0.08
R5599:Lrp1	UTSW	10	127593869	missense	probably damaging	1.00
R5639:Lrp1	UTSW	10	127593839	missense	probably damaging	0.99
R5677:Lrp1	UTSW	10	127574429	missense	probably damaging	1.00
R5730:Lrp1	UTSW	10	127583834	missense	probably benign	0.00
R5742:Lrp1	UTSW	10	127548347	missense	probably damaging	0.98
R5764:Lrp1	UTSW	10	127595318	missense	probably benign	0.41
R5864:Lrp1	UTSW	10	127567505	missense	possibly damaging	0.58
R5937:Lrp1	UTSW	10	127583876	missense	possibly damaging	0.93
R5947:Lrp1	UTSW	10	127589554	critical splice donor site	probably null
R5976:Lrp1	UTSW	10	127583901	missense	probably damaging	1.00
R6021:Lrp1	UTSW	10	127578014	missense	probably damaging	1.00
R6026:Lrp1	UTSW	10	127573403	missense	probably damaging	1.00
R6045:Lrp1	UTSW	10	127566600	missense	probably damaging	0.98
R6057:Lrp1	UTSW	10	127567490	missense	probably damaging	1.00
R6084:Lrp1	UTSW	10	127560553	missense	probably benign	0.09
R6131:Lrp1	UTSW	10	127560157	missense	probably benign
R6235:Lrp1	UTSW	10	127588177	missense	probably damaging	1.00
R6280:Lrp1	UTSW	10	127589584	missense	probably benign	0.04
R6307:Lrp1	UTSW	10	127592075	missense	probably damaging	1.00
R6532:Lrp1	UTSW	10	127541682	missense	probably damaging	1.00
R6532:Lrp1	UTSW	10	127549407	missense	probably damaging	1.00
R6536:Lrp1	UTSW	10	127558068	splice site	probably null
R6605:Lrp1	UTSW	10	127560136	missense	probably damaging	1.00
R6607:Lrp1	UTSW	10	127560136	missense	probably damaging	1.00
R6631:Lrp1	UTSW	10	127574332	missense	probably damaging	1.00
R6676:Lrp1	UTSW	10	127560136	missense	probably damaging	1.00
R6678:Lrp1	UTSW	10	127560136	missense	probably damaging	1.00
R6809:Lrp1	UTSW	10	127555056	missense	probably benign	0.04
R6884:Lrp1	UTSW	10	127559117	missense	probably benign	0.00
R6925:Lrp1	UTSW	10	127556988	missense	probably benign	0.00
R6987:Lrp1	UTSW	10	127575005	missense	probably damaging	1.00
R7016:Lrp1	UTSW	10	127559967	critical splice donor site	probably null
R7030:Lrp1	UTSW	10	127552876	missense	probably damaging	0.97
R7053:Lrp1	UTSW	10	127541094	missense	probably damaging	1.00
R7076:Lrp1	UTSW	10	127550183	critical splice donor site	probably null
R7136:Lrp1	UTSW	10	127558622	missense	probably damaging	1.00
R7180:Lrp1	UTSW	10	127556965	missense	probably damaging	1.00
R7199:Lrp1	UTSW	10	127573456	missense	probably damaging	0.99
R7219:Lrp1	UTSW	10	127557228	missense	probably benign	0.40
R7233:Lrp1	UTSW	10	127595061	missense	probably damaging	1.00
R7251:Lrp1	UTSW	10	127572554	missense	probably damaging	1.00
R7264:Lrp1	UTSW	10	127592093	missense	probably damaging	1.00
R7302:Lrp1	UTSW	10	127538987	missense	probably benign	0.01
R7313:Lrp1	UTSW	10	127553468	missense	probably damaging	1.00
R7322:Lrp1	UTSW	10	127545564	missense	probably benign	0.24
R7354:Lrp1	UTSW	10	127571408	missense	probably damaging	1.00
R7375:Lrp1	UTSW	10	127539348	missense	probably damaging	1.00
R7388:Lrp1	UTSW	10	127583897	nonsense	probably null
R7404:Lrp1	UTSW	10	127582708	missense
R7405:Lrp1	UTSW	10	127581751	missense	possibly damaging	0.93
R7477:Lrp1	UTSW	10	127568920	missense	probably damaging	1.00
R7555:Lrp1	UTSW	10	127546862	missense	probably damaging	1.00
R7600:Lrp1	UTSW	10	127555706	missense	probably benign
R7678:Lrp1	UTSW	10	127574053	missense	probably damaging	1.00
R7679:Lrp1	UTSW	10	127588428	nonsense	probably null
R7951:Lrp1	UTSW	10	127539064	nonsense	probably null
R7964:Lrp1	UTSW	10	127575044	missense	possibly damaging	0.94
R8006:Lrp1	UTSW	10	127589619	missense	probably damaging	1.00
R8021:Lrp1	UTSW	10	127548346	missense	possibly damaging	0.92
R8098:Lrp1	UTSW	10	127574455	missense	possibly damaging	0.78
R8112:Lrp1	UTSW	10	127605846	missense	probably damaging	1.00
R8210:Lrp1	UTSW	10	127576485	missense	probably damaging	1.00
R8249:Lrp1	UTSW	10	127605543	missense	probably benign
R8291:Lrp1	UTSW	10	127589703	missense	probably damaging	1.00
R8332:Lrp1	UTSW	10	127571936	missense	probably damaging	1.00
R8435:Lrp1	UTSW	10	127556330	missense	probably damaging	0.97
R8467:Lrp1	UTSW	10	127558650	missense	probably damaging	1.00
R8468:Lrp1	UTSW	10	127558650	missense	probably damaging	1.00
R8474:Lrp1	UTSW	10	127539703	missense	probably damaging	1.00
R8481:Lrp1	UTSW	10	127568910	missense	probably damaging	1.00
R8483:Lrp1	UTSW	10	127558650	missense	probably damaging	1.00
R8485:Lrp1	UTSW	10	127558650	missense	probably damaging	1.00
R8488:Lrp1	UTSW	10	127560487	missense	probably damaging	1.00
R8715:Lrp1	UTSW	10	127560621	missense	possibly damaging	0.77
R8790:Lrp1	UTSW	10	127539077	missense	probably damaging	1.00
R8854:Lrp1	UTSW	10	127543099	missense	probably damaging	1.00
R8926:Lrp1	UTSW	10	127545802	missense	probably benign
R8949:Lrp1	UTSW	10	127589536	intron	probably benign
R8971:Lrp1	UTSW	10	127556027	missense	possibly damaging	0.94
R9103:Lrp1	UTSW	10	127595110	nonsense	probably null
R9108:Lrp1	UTSW	10	127554337	missense	probably damaging	0.99
R9130:Lrp1	UTSW	10	127546412	missense	probably benign	0.18
R9157:Lrp1	UTSW	10	127574340	missense	probably damaging	1.00
R9162:Lrp1	UTSW	10	127605499	missense	probably benign	0.32
R9205:Lrp1	UTSW	10	127594981	nonsense	probably null
R9228:Lrp1	UTSW	10	127546938	missense	probably damaging	0.98
R9231:Lrp1	UTSW	10	127546399	missense	probably benign	0.06
R9287:Lrp1	UTSW	10	127567364	missense	probably damaging	1.00
R9381:Lrp1	UTSW	10	127605468	missense	probably benign	0.17
R9412:Lrp1	UTSW	10	127573418	missense	probably damaging	1.00
R9434:Lrp1	UTSW	10	127545820	missense	possibly damaging	0.93
R9463:Lrp1	UTSW	10	127593465	nonsense	probably null
R9526:Lrp1	UTSW	10	127595360	missense	probably damaging	0.96
R9548:Lrp1	UTSW	10	127552864	missense	probably damaging	0.99
R9599:Lrp1	UTSW	10	127574377	missense	probably damaging	1.00
R9649:Lrp1	UTSW	10	127573499	missense	probably benign	0.14
R9687:Lrp1	UTSW	10	127566693	missense	probably damaging	1.00
R9707:Lrp1	UTSW	10	127572545	missense	probably benign	0.08
R9770:Lrp1	UTSW	10	127584399	missense	probably damaging	1.00
V3553:Lrp1	UTSW	10	127571442	missense	probably damaging	1.00
Y5406:Lrp1	UTSW	10	127554283	missense	probably damaging	1.00
Z1088:Lrp1	UTSW	10	127584379	missense	probably damaging	1.00
Z1176:Lrp1	UTSW	10	127554962	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGATGGCCTCCTCCTACTC -3'
(R):5'- TGAGTCTCTCGATGAGTTAGAGC -3'

Sequencing Primer
(F):5'- GATGGCCTCCTCCTACTCATGAAG -3'
(R):5'- AGAGCTTTCTGGCTATCGGC -3'

Posted On

2014-06-23