Incidental Mutation 'R1845:Suox'
ID207665
Institutional Source Beutler Lab
Gene Symbol Suox
Ensembl Gene ENSMUSG00000049858
Gene Namesulfite oxidase
Synonyms
MMRRC Submission 039870-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.558) question?
Stock #R1845 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128669894-128674073 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128670539 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 540 (V540A)
Ref Sequence ENSEMBL: ENSMUSP00000056195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054764]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054764
AA Change: V540A

PolyPhen 2 Score 0.563 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000056195
Gene: ENSMUSG00000049858
AA Change: V540A

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
Cyt-b5 86 162 3.41e-13 SMART
Pfam:Oxidored_molyb 220 396 1.2e-62 PFAM
Pfam:Mo-co_dimer 418 545 1.7e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217817
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfite oxidase is a homodimeric protein localized to the intermembrane space of mitochondria. Each subunit contains a heme domain and a molybdopterin-binding domain. The enzyme catalyzes the oxidation of sulfite to sulfate, the final reaction in the oxidative degradation of the sulfur amino acids cysteine and methionine. Sulfite oxidase deficiency results in neurological abnormalities which are often fatal at an early age. Alternative splicing results in multiple transcript variants encoding identical proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,304,332 I142N possibly damaging Het
1110038F14Rik CGGG CGGGGGG 15: 76,949,663 probably benign Het
Abca17 A T 17: 24,267,716 C1446S probably damaging Het
Asb16 C A 11: 102,276,756 A316E possibly damaging Het
Axdnd1 C T 1: 156,376,544 V384I possibly damaging Het
BC024139 A T 15: 76,125,261 L207* probably null Het
Bcl3 T G 7: 19,809,627 S305R probably damaging Het
Cachd1 T C 4: 100,777,358 V77A probably benign Het
Cd101 C T 3: 101,029,448 probably null Het
Cela1 T C 15: 100,685,167 N64S probably benign Het
Cep128 T C 12: 91,289,598 D366G probably benign Het
Col12a1 A G 9: 79,697,541 V675A probably benign Het
Copg1 A G 6: 87,893,818 Y201C probably damaging Het
Cyp24a1 T C 2: 170,487,917 R372G probably benign Het
Dcaf1 A C 9: 106,851,962 I567L probably benign Het
Dcn A G 10: 97,506,674 D164G probably benign Het
Dnase2a T A 8: 84,909,322 H113Q probably benign Het
Espl1 T C 15: 102,299,013 V304A probably benign Het
Fam193a A G 5: 34,443,372 D315G possibly damaging Het
Fkbp8 T A 8: 70,531,035 probably null Het
Foxp4 T A 17: 47,877,959 T321S probably null Het
Fut10 A G 8: 31,236,300 N361S probably damaging Het
Gm13762 A G 2: 88,973,138 V251A probably benign Het
Gyg A T 3: 20,151,122 V94D probably damaging Het
Has2 T C 15: 56,668,578 K247R probably damaging Het
Helz2 G T 2: 181,232,085 D2205E probably benign Het
Hps6 T A 19: 46,004,970 S449T probably benign Het
Ints10 T C 8: 68,794,671 Y64H probably damaging Het
Kalrn T C 16: 34,356,961 H278R probably damaging Het
Klhdc8a T C 1: 132,303,810 V280A possibly damaging Het
Klk1b5 A G 7: 44,220,125 M210V probably benign Het
Kmt2c G A 5: 25,373,436 A614V probably benign Het
Lck T A 4: 129,558,086 I45F probably benign Het
Lin7a A C 10: 107,412,059 E75A probably damaging Het
Lrp1 A T 10: 127,578,673 C1070S probably damaging Het
Mapk8ip3 G T 17: 24,914,583 N289K probably benign Het
Mbtps1 T C 8: 119,522,493 D686G probably benign Het
Mknk1 T A 4: 115,873,231 C178* probably null Het
Mtmr6 A G 14: 60,296,735 N474S probably damaging Het
Mvb12b A G 2: 33,840,157 probably null Het
Myh6 T C 14: 54,944,674 K1759R probably damaging Het
Nfatc1 T C 18: 80,635,531 K881E possibly damaging Het
Nlrp10 A G 7: 108,927,041 F30S probably damaging Het
Nop14 G T 5: 34,650,328 A430E possibly damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1212 A G 2: 88,958,867 I134V probably damaging Het
Olfr347 A T 2: 36,734,842 I174F probably damaging Het
Olfr775 A G 10: 129,250,594 E20G probably benign Het
Olfr794 A T 10: 129,571,348 Q231L probably damaging Het
Olfr829 A T 9: 18,857,486 Y287F possibly damaging Het
Osbpl7 C A 11: 97,059,128 S378R probably damaging Het
Otof A T 5: 30,371,723 Y1775* probably null Het
Parp16 T C 9: 65,215,594 S46P possibly damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pi16 A T 17: 29,319,387 Q58L possibly damaging Het
Pld3 C A 7: 27,539,452 M190I probably benign Het
Plscr4 T G 9: 92,490,046 I290S probably damaging Het
Ppip5k2 T C 1: 97,723,806 D928G possibly damaging Het
Ppp1r13l T A 7: 19,368,611 L15Q probably damaging Het
Ptpn14 C A 1: 189,839,502 S263R possibly damaging Het
Sema7a G A 9: 57,954,899 V178I possibly damaging Het
Sesn2 A T 4: 132,497,070 Y342* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sltm A G 9: 70,543,032 N38S possibly damaging Het
Smg1 T C 7: 118,154,622 probably benign Het
Spsb1 A T 4: 149,906,910 V67E probably damaging Het
Tbc1d12 T A 19: 38,911,085 I483N probably damaging Het
Tbcb A T 7: 30,224,499 D198E possibly damaging Het
Tbce T C 13: 14,019,709 K122E probably benign Het
Tcap T A 11: 98,384,379 L113H probably damaging Het
Thsd7a A T 6: 12,321,041 I1545N probably damaging Het
Tmed10 T C 12: 85,374,503 T55A possibly damaging Het
Tmem268 T A 4: 63,579,943 V200D probably damaging Het
Tmem45b A C 9: 31,431,355 I50M probably damaging Het
Trp53bp2 T C 1: 182,458,903 W1103R probably damaging Het
Ttn C T 2: 76,764,033 V20524M probably damaging Het
Ulk2 A T 11: 61,812,738 N379K probably benign Het
Vmn1r59 A G 7: 5,454,554 V69A probably benign Het
Vmn2r10 A T 5: 109,001,995 Y394* probably null Het
Zfp212 T C 6: 47,931,541 S485P probably benign Het
Zfp512b A T 2: 181,585,735 C776S probably damaging Het
Zfp518b A G 5: 38,671,741 Y974H probably damaging Het
Other mutations in Suox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Suox APN 10 128672098 splice site probably benign
IGL02744:Suox APN 10 128671217 missense probably benign 0.00
PIT4402001:Suox UTSW 10 128671295 missense probably damaging 1.00
R0414:Suox UTSW 10 128671457 missense probably benign 0.01
R0418:Suox UTSW 10 128670885 missense probably damaging 1.00
R0612:Suox UTSW 10 128670656 missense probably benign
R3976:Suox UTSW 10 128671037 missense probably damaging 0.96
R4808:Suox UTSW 10 128671889 missense possibly damaging 0.81
R5098:Suox UTSW 10 128671158 missense probably damaging 1.00
R5587:Suox UTSW 10 128671825 missense probably damaging 1.00
R5721:Suox UTSW 10 128671293 missense possibly damaging 0.55
R6968:Suox UTSW 10 128671833 missense possibly damaging 0.92
R7378:Suox UTSW 10 128671041 missense probably benign 0.05
R7669:Suox UTSW 10 128670911 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCAGTGTCTTTCGAGCTGC -3'
(R):5'- ACTAACCTGGCAGGAAGCTG -3'

Sequencing Primer
(F):5'- TCTCTCCAAGCACAGGGTCAG -3'
(R):5'- CCTGGCAGGAAGCTGAGCTAG -3'
Posted On2014-06-23