Mutagenetix > Incidental Mutation

Incidental Mutation 'R1845:Espl1'

207683

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

039870-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1845 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 102299013 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 304 (V304A)

Ref Sequence

ENSEMBL: ENSMUSP00000155304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050] [ENSMUST00000230212] [ENSMUST00000231104]

AlphaFold

P60330

Predicted Effect

probably benign
Transcript: ENSMUST00000064924
AA Change: V304A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: V304A

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000229050
AA Change: V304A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229580

Predicted Effect

probably benign
Transcript: ENSMUST00000230212

Predicted Effect

probably benign
Transcript: ENSMUST00000231104

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	T	A	12: 55,304,332	I142N	possibly damaging	Het
1110038F14Rik	CGGG	CGGGGGG	15: 76,949,663		probably benign	Het
Abca17	A	T	17: 24,267,716	C1446S	probably damaging	Het
Asb16	C	A	11: 102,276,756	A316E	possibly damaging	Het
Axdnd1	C	T	1: 156,376,544	V384I	possibly damaging	Het
BC024139	A	T	15: 76,125,261	L207*	probably null	Het
Bcl3	T	G	7: 19,809,627	S305R	probably damaging	Het
Cachd1	T	C	4: 100,777,358	V77A	probably benign	Het
Cd101	C	T	3: 101,029,448		probably null	Het
Cela1	T	C	15: 100,685,167	N64S	probably benign	Het
Cep128	T	C	12: 91,289,598	D366G	probably benign	Het
Col12a1	A	G	9: 79,697,541	V675A	probably benign	Het
Copg1	A	G	6: 87,893,818	Y201C	probably damaging	Het
Cyp24a1	T	C	2: 170,487,917	R372G	probably benign	Het
Dcaf1	A	C	9: 106,851,962	I567L	probably benign	Het
Dcn	A	G	10: 97,506,674	D164G	probably benign	Het
Dnase2a	T	A	8: 84,909,322	H113Q	probably benign	Het
Fam193a	A	G	5: 34,443,372	D315G	possibly damaging	Het
Fkbp8	T	A	8: 70,531,035		probably null	Het
Foxp4	T	A	17: 47,877,959	T321S	probably null	Het
Fut10	A	G	8: 31,236,300	N361S	probably damaging	Het
Gm13762	A	G	2: 88,973,138	V251A	probably benign	Het
Gyg	A	T	3: 20,151,122	V94D	probably damaging	Het
Has2	T	C	15: 56,668,578	K247R	probably damaging	Het
Helz2	G	T	2: 181,232,085	D2205E	probably benign	Het
Hps6	T	A	19: 46,004,970	S449T	probably benign	Het
Ints10	T	C	8: 68,794,671	Y64H	probably damaging	Het
Kalrn	T	C	16: 34,356,961	H278R	probably damaging	Het
Klhdc8a	T	C	1: 132,303,810	V280A	possibly damaging	Het
Klk1b5	A	G	7: 44,220,125	M210V	probably benign	Het
Kmt2c	G	A	5: 25,373,436	A614V	probably benign	Het
Lck	T	A	4: 129,558,086	I45F	probably benign	Het
Lin7a	A	C	10: 107,412,059	E75A	probably damaging	Het
Lrp1	A	T	10: 127,578,673	C1070S	probably damaging	Het
Mapk8ip3	G	T	17: 24,914,583	N289K	probably benign	Het
Mbtps1	T	C	8: 119,522,493	D686G	probably benign	Het
Mknk1	T	A	4: 115,873,231	C178*	probably null	Het
Mtmr6	A	G	14: 60,296,735	N474S	probably damaging	Het
Mvb12b	A	G	2: 33,840,157		probably null	Het
Myh6	T	C	14: 54,944,674	K1759R	probably damaging	Het
Nfatc1	T	C	18: 80,635,531	K881E	possibly damaging	Het
Nlrp10	A	G	7: 108,927,041	F30S	probably damaging	Het
Nop14	G	T	5: 34,650,328	A430E	possibly damaging	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Olfr1212	A	G	2: 88,958,867	I134V	probably damaging	Het
Olfr347	A	T	2: 36,734,842	I174F	probably damaging	Het
Olfr775	A	G	10: 129,250,594	E20G	probably benign	Het
Olfr794	A	T	10: 129,571,348	Q231L	probably damaging	Het
Olfr829	A	T	9: 18,857,486	Y287F	possibly damaging	Het
Osbpl7	C	A	11: 97,059,128	S378R	probably damaging	Het
Otof	A	T	5: 30,371,723	Y1775*	probably null	Het
Parp16	T	C	9: 65,215,594	S46P	possibly damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pi16	A	T	17: 29,319,387	Q58L	possibly damaging	Het
Pld3	C	A	7: 27,539,452	M190I	probably benign	Het
Plscr4	T	G	9: 92,490,046	I290S	probably damaging	Het
Ppip5k2	T	C	1: 97,723,806	D928G	possibly damaging	Het
Ppp1r13l	T	A	7: 19,368,611	L15Q	probably damaging	Het
Ptpn14	C	A	1: 189,839,502	S263R	possibly damaging	Het
Sema7a	G	A	9: 57,954,899	V178I	possibly damaging	Het
Sesn2	A	T	4: 132,497,070	Y342*	probably null	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Sltm	A	G	9: 70,543,032	N38S	possibly damaging	Het
Smg1	T	C	7: 118,154,622		probably benign	Het
Spsb1	A	T	4: 149,906,910	V67E	probably damaging	Het
Suox	A	G	10: 128,670,539	V540A	possibly damaging	Het
Tbc1d12	T	A	19: 38,911,085	I483N	probably damaging	Het
Tbcb	A	T	7: 30,224,499	D198E	possibly damaging	Het
Tbce	T	C	13: 14,019,709	K122E	probably benign	Het
Tcap	T	A	11: 98,384,379	L113H	probably damaging	Het
Thsd7a	A	T	6: 12,321,041	I1545N	probably damaging	Het
Tmed10	T	C	12: 85,374,503	T55A	possibly damaging	Het
Tmem268	T	A	4: 63,579,943	V200D	probably damaging	Het
Tmem45b	A	C	9: 31,431,355	I50M	probably damaging	Het
Trp53bp2	T	C	1: 182,458,903	W1103R	probably damaging	Het
Ttn	C	T	2: 76,764,033	V20524M	probably damaging	Het
Ulk2	A	T	11: 61,812,738	N379K	probably benign	Het
Vmn1r59	A	G	7: 5,454,554	V69A	probably benign	Het
Vmn2r10	A	T	5: 109,001,995	Y394*	probably null	Het
Zfp212	T	C	6: 47,931,541	S485P	probably benign	Het
Zfp512b	A	T	2: 181,585,735	C776S	probably damaging	Het
Zfp518b	A	G	5: 38,671,741	Y974H	probably damaging	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACCTGATCAGAGTCTTAGTAGG -3'
(R):5'- TGGCATCAAGTCCACAGTG -3'

Sequencing Primer
(F):5'- CCTGATCAGAGTCTTAGTAGGTGAGG -3'
(R):5'- AAGTCCACAGTGCCTCCTGATG -3'

Posted On

2014-06-23