Incidental Mutation 'R1845:Foxp4'
ID207689
Institutional Source Beutler Lab
Gene Symbol Foxp4
Ensembl Gene ENSMUSG00000023991
Gene Nameforkhead box P4
Synonyms
MMRRC Submission 039870-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.806) question?
Stock #R1845 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location47867133-47924645 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 47877959 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 321 (T321S)
Ref Sequence ENSEMBL: ENSMUSP00000108890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097311] [ENSMUST00000113262] [ENSMUST00000113263] [ENSMUST00000113265]
Predicted Effect probably null
Transcript: ENSMUST00000097311
AA Change: T322S
SMART Domains Protein: ENSMUSP00000094916
Gene: ENSMUSG00000023991
AA Change: T322S

DomainStartEndE-ValueType
low complexity region 27 46 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 100 173 N/A INTRINSIC
low complexity region 182 208 N/A INTRINSIC
low complexity region 259 270 N/A INTRINSIC
low complexity region 297 308 N/A INTRINSIC
ZnF_C2H2 313 338 3.47e0 SMART
FH 470 552 4.69e-38 SMART
low complexity region 644 658 N/A INTRINSIC
low complexity region 671 683 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113262
AA Change: T322S
SMART Domains Protein: ENSMUSP00000108887
Gene: ENSMUSG00000023991
AA Change: T322S

DomainStartEndE-ValueType
low complexity region 27 46 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 100 173 N/A INTRINSIC
low complexity region 182 208 N/A INTRINSIC
low complexity region 259 270 N/A INTRINSIC
low complexity region 297 308 N/A INTRINSIC
ZnF_C2H2 313 338 3.47e0 SMART
FH 458 540 4.69e-38 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 659 671 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113263
AA Change: T320S
SMART Domains Protein: ENSMUSP00000108888
Gene: ENSMUSG00000023991
AA Change: T320S

DomainStartEndE-ValueType
low complexity region 27 46 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 100 171 N/A INTRINSIC
low complexity region 180 206 N/A INTRINSIC
low complexity region 257 268 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
ZnF_C2H2 311 336 3.47e0 SMART
FH 468 550 4.69e-38 SMART
low complexity region 642 656 N/A INTRINSIC
low complexity region 669 681 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113265
AA Change: T321S
SMART Domains Protein: ENSMUSP00000108890
Gene: ENSMUSG00000023991
AA Change: T321S

DomainStartEndE-ValueType
low complexity region 27 46 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 100 173 N/A INTRINSIC
low complexity region 182 208 N/A INTRINSIC
internal_repeat_1 214 282 3.94e-5 PROSPERO
low complexity region 296 307 N/A INTRINSIC
ZnF_C2H2 312 337 3.47e0 SMART
FH 457 539 4.69e-38 SMART
internal_repeat_1 571 627 3.94e-5 PROSPERO
low complexity region 631 645 N/A INTRINSIC
low complexity region 658 670 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154108
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to subfamily P of the forkhead box (FOX) transcription factor family. Forkhead box transcription factors play important roles in the regulation of tissue- and cell type-specific gene transcription during both development and adulthood. Many members of the forkhead box gene family, including members of subfamily P, have roles in mammalian oncogenesis. This gene may play a role in the development of tumors of the kidney and larynx. Alternative splicing of this gene produces multiple transcript variants, some encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die before E12.5. Foregut closure is delayed leading to the development of two beating hearts and to the failure of the trachea and esophagus to separate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,304,332 I142N possibly damaging Het
1110038F14Rik CGGG CGGGGGG 15: 76,949,663 probably benign Het
Abca17 A T 17: 24,267,716 C1446S probably damaging Het
Asb16 C A 11: 102,276,756 A316E possibly damaging Het
Axdnd1 C T 1: 156,376,544 V384I possibly damaging Het
BC024139 A T 15: 76,125,261 L207* probably null Het
Bcl3 T G 7: 19,809,627 S305R probably damaging Het
Cachd1 T C 4: 100,777,358 V77A probably benign Het
Cd101 C T 3: 101,029,448 probably null Het
Cela1 T C 15: 100,685,167 N64S probably benign Het
Cep128 T C 12: 91,289,598 D366G probably benign Het
Col12a1 A G 9: 79,697,541 V675A probably benign Het
Copg1 A G 6: 87,893,818 Y201C probably damaging Het
Cyp24a1 T C 2: 170,487,917 R372G probably benign Het
Dcaf1 A C 9: 106,851,962 I567L probably benign Het
Dcn A G 10: 97,506,674 D164G probably benign Het
Dnase2a T A 8: 84,909,322 H113Q probably benign Het
Espl1 T C 15: 102,299,013 V304A probably benign Het
Fam193a A G 5: 34,443,372 D315G possibly damaging Het
Fkbp8 T A 8: 70,531,035 probably null Het
Fut10 A G 8: 31,236,300 N361S probably damaging Het
Gm13762 A G 2: 88,973,138 V251A probably benign Het
Gyg A T 3: 20,151,122 V94D probably damaging Het
Has2 T C 15: 56,668,578 K247R probably damaging Het
Helz2 G T 2: 181,232,085 D2205E probably benign Het
Hps6 T A 19: 46,004,970 S449T probably benign Het
Ints10 T C 8: 68,794,671 Y64H probably damaging Het
Kalrn T C 16: 34,356,961 H278R probably damaging Het
Klhdc8a T C 1: 132,303,810 V280A possibly damaging Het
Klk1b5 A G 7: 44,220,125 M210V probably benign Het
Kmt2c G A 5: 25,373,436 A614V probably benign Het
Lck T A 4: 129,558,086 I45F probably benign Het
Lin7a A C 10: 107,412,059 E75A probably damaging Het
Lrp1 A T 10: 127,578,673 C1070S probably damaging Het
Mapk8ip3 G T 17: 24,914,583 N289K probably benign Het
Mbtps1 T C 8: 119,522,493 D686G probably benign Het
Mknk1 T A 4: 115,873,231 C178* probably null Het
Mtmr6 A G 14: 60,296,735 N474S probably damaging Het
Mvb12b A G 2: 33,840,157 probably null Het
Myh6 T C 14: 54,944,674 K1759R probably damaging Het
Nfatc1 T C 18: 80,635,531 K881E possibly damaging Het
Nlrp10 A G 7: 108,927,041 F30S probably damaging Het
Nop14 G T 5: 34,650,328 A430E possibly damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1212 A G 2: 88,958,867 I134V probably damaging Het
Olfr347 A T 2: 36,734,842 I174F probably damaging Het
Olfr775 A G 10: 129,250,594 E20G probably benign Het
Olfr794 A T 10: 129,571,348 Q231L probably damaging Het
Olfr829 A T 9: 18,857,486 Y287F possibly damaging Het
Osbpl7 C A 11: 97,059,128 S378R probably damaging Het
Otof A T 5: 30,371,723 Y1775* probably null Het
Parp16 T C 9: 65,215,594 S46P possibly damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pi16 A T 17: 29,319,387 Q58L possibly damaging Het
Pld3 C A 7: 27,539,452 M190I probably benign Het
Plscr4 T G 9: 92,490,046 I290S probably damaging Het
Ppip5k2 T C 1: 97,723,806 D928G possibly damaging Het
Ppp1r13l T A 7: 19,368,611 L15Q probably damaging Het
Ptpn14 C A 1: 189,839,502 S263R possibly damaging Het
Sema7a G A 9: 57,954,899 V178I possibly damaging Het
Sesn2 A T 4: 132,497,070 Y342* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sltm A G 9: 70,543,032 N38S possibly damaging Het
Smg1 T C 7: 118,154,622 probably benign Het
Spsb1 A T 4: 149,906,910 V67E probably damaging Het
Suox A G 10: 128,670,539 V540A possibly damaging Het
Tbc1d12 T A 19: 38,911,085 I483N probably damaging Het
Tbcb A T 7: 30,224,499 D198E possibly damaging Het
Tbce T C 13: 14,019,709 K122E probably benign Het
Tcap T A 11: 98,384,379 L113H probably damaging Het
Thsd7a A T 6: 12,321,041 I1545N probably damaging Het
Tmed10 T C 12: 85,374,503 T55A possibly damaging Het
Tmem268 T A 4: 63,579,943 V200D probably damaging Het
Tmem45b A C 9: 31,431,355 I50M probably damaging Het
Trp53bp2 T C 1: 182,458,903 W1103R probably damaging Het
Ttn C T 2: 76,764,033 V20524M probably damaging Het
Ulk2 A T 11: 61,812,738 N379K probably benign Het
Vmn1r59 A G 7: 5,454,554 V69A probably benign Het
Vmn2r10 A T 5: 109,001,995 Y394* probably null Het
Zfp212 T C 6: 47,931,541 S485P probably benign Het
Zfp512b A T 2: 181,585,735 C776S probably damaging Het
Zfp518b A G 5: 38,671,741 Y974H probably damaging Het
Other mutations in Foxp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01353:Foxp4 APN 17 47888153 missense probably damaging 1.00
IGL02454:Foxp4 APN 17 47875582 nonsense probably null
IGL03048:Foxp4 UTSW 17 47880840 missense unknown
R0138:Foxp4 UTSW 17 47869179 missense unknown
R1180:Foxp4 UTSW 17 47880353 splice site probably benign
R1268:Foxp4 UTSW 17 47880353 splice site probably benign
R1282:Foxp4 UTSW 17 47875643 missense unknown
R1494:Foxp4 UTSW 17 47880353 splice site probably benign
R1956:Foxp4 UTSW 17 47875871 missense unknown
R1958:Foxp4 UTSW 17 47875871 missense unknown
R1969:Foxp4 UTSW 17 47875871 missense unknown
R1970:Foxp4 UTSW 17 47875871 missense unknown
R1971:Foxp4 UTSW 17 47875871 missense unknown
R2240:Foxp4 UTSW 17 47871276 missense unknown
R3847:Foxp4 UTSW 17 47875528 missense unknown
R3848:Foxp4 UTSW 17 47875528 missense unknown
R3849:Foxp4 UTSW 17 47875528 missense unknown
R4345:Foxp4 UTSW 17 47874648 missense unknown
R5572:Foxp4 UTSW 17 47880879 missense unknown
R5726:Foxp4 UTSW 17 47869108 missense unknown
R6386:Foxp4 UTSW 17 47878462 missense unknown
R6510:Foxp4 UTSW 17 47875410 missense unknown
X0025:Foxp4 UTSW 17 47877965 missense unknown
Predicted Primers PCR Primer
(F):5'- GAGATAGGCTTCCTCCTCTGAC -3'
(R):5'- TGCTGGACCAGTAGTAGAGAC -3'

Sequencing Primer
(F):5'- TGACACCCCTGCTCTGGAG -3'
(R):5'- CAAAAGCTGGGCCCAGG -3'
Posted On2014-06-23