Mutagenetix > Incidental Mutation

Incidental Mutation 'R1845:Nfatc1'

207690

Institutional Source

Beutler Lab

Gene Symbol

Nfatc1

Ensembl Gene

ENSMUSG00000033016

Gene Name

nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1

Synonyms

NFATc, NFAT2, 2210017P03Rik, NF-ATc

MMRRC Submission

039870-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1845 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80606205-80713071 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80635531 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 881 (K881E)

Ref Sequence

ENSEMBL: ENSMUSP00000129001 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078049] [ENSMUST00000167977] [ENSMUST00000170905]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000078049

SMART Domains

Protein: ENSMUSP00000077196
Gene: ENSMUSG00000033016

Domain	Start	End	E-Value	Type
low complexity region	170	202	N/A	INTRINSIC
low complexity region	277	293	N/A	INTRINSIC
Pfam:RHD	429	589	1.3e-27	PFAM
IPT	596	695	8.99e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167977
AA Change: K867E

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000126884
Gene: ENSMUSG00000033016
AA Change: K867E

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
low complexity region	156	188	N/A	INTRINSIC
low complexity region	263	279	N/A	INTRINSIC
Pfam:RHD	415	575	4.9e-28	PFAM
IPT	582	681	8.99e-21	SMART
low complexity region	832	841	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170905
AA Change: K881E

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000129001
Gene: ENSMUSG00000033016
AA Change: K881E

Domain	Start	End	E-Value	Type
low complexity region	170	202	N/A	INTRINSIC
low complexity region	277	293	N/A	INTRINSIC
Pfam:RHD_DNA_bind	429	589	5.1e-28	PFAM
IPT	596	695	8.99e-21	SMART
low complexity region	846	855	N/A	INTRINSIC

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the nuclear factor of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation, and an inducible nuclear component. Proteins belonging to this family of transcription factors play a central role in inducible gene transcription during immune response. The product of this gene is an inducible nuclear component. It functions as a major molecular target for the immunosuppressive drugs such as cyclosporin A. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Different isoforms of this protein may regulate inducible expression of different cytokine genes. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality throughout fetal growth and development due to cardiac failure. Mutants exhibit blood circulation, cardiac valve and ventricular septal abnormalities, edema, abdominal hemorrhage, and semilunar valveregurgitation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	T	A	12: 55,304,332	I142N	possibly damaging	Het
1110038F14Rik	CGGG	CGGGGGG	15: 76,949,663		probably benign	Het
Abca17	A	T	17: 24,267,716	C1446S	probably damaging	Het
Asb16	C	A	11: 102,276,756	A316E	possibly damaging	Het
Axdnd1	C	T	1: 156,376,544	V384I	possibly damaging	Het
BC024139	A	T	15: 76,125,261	L207*	probably null	Het
Bcl3	T	G	7: 19,809,627	S305R	probably damaging	Het
Cachd1	T	C	4: 100,777,358	V77A	probably benign	Het
Cd101	C	T	3: 101,029,448		probably null	Het
Cela1	T	C	15: 100,685,167	N64S	probably benign	Het
Cep128	T	C	12: 91,289,598	D366G	probably benign	Het
Col12a1	A	G	9: 79,697,541	V675A	probably benign	Het
Copg1	A	G	6: 87,893,818	Y201C	probably damaging	Het
Cyp24a1	T	C	2: 170,487,917	R372G	probably benign	Het
Dcaf1	A	C	9: 106,851,962	I567L	probably benign	Het
Dcn	A	G	10: 97,506,674	D164G	probably benign	Het
Dnase2a	T	A	8: 84,909,322	H113Q	probably benign	Het
Espl1	T	C	15: 102,299,013	V304A	probably benign	Het
Fam193a	A	G	5: 34,443,372	D315G	possibly damaging	Het
Fkbp8	T	A	8: 70,531,035		probably null	Het
Foxp4	T	A	17: 47,877,959	T321S	probably null	Het
Fut10	A	G	8: 31,236,300	N361S	probably damaging	Het
Gm13762	A	G	2: 88,973,138	V251A	probably benign	Het
Gyg	A	T	3: 20,151,122	V94D	probably damaging	Het
Has2	T	C	15: 56,668,578	K247R	probably damaging	Het
Helz2	G	T	2: 181,232,085	D2205E	probably benign	Het
Hps6	T	A	19: 46,004,970	S449T	probably benign	Het
Ints10	T	C	8: 68,794,671	Y64H	probably damaging	Het
Kalrn	T	C	16: 34,356,961	H278R	probably damaging	Het
Klhdc8a	T	C	1: 132,303,810	V280A	possibly damaging	Het
Klk1b5	A	G	7: 44,220,125	M210V	probably benign	Het
Kmt2c	G	A	5: 25,373,436	A614V	probably benign	Het
Lck	T	A	4: 129,558,086	I45F	probably benign	Het
Lin7a	A	C	10: 107,412,059	E75A	probably damaging	Het
Lrp1	A	T	10: 127,578,673	C1070S	probably damaging	Het
Mapk8ip3	G	T	17: 24,914,583	N289K	probably benign	Het
Mbtps1	T	C	8: 119,522,493	D686G	probably benign	Het
Mknk1	T	A	4: 115,873,231	C178*	probably null	Het
Mtmr6	A	G	14: 60,296,735	N474S	probably damaging	Het
Mvb12b	A	G	2: 33,840,157		probably null	Het
Myh6	T	C	14: 54,944,674	K1759R	probably damaging	Het
Nlrp10	A	G	7: 108,927,041	F30S	probably damaging	Het
Nop14	G	T	5: 34,650,328	A430E	possibly damaging	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Olfr1212	A	G	2: 88,958,867	I134V	probably damaging	Het
Olfr347	A	T	2: 36,734,842	I174F	probably damaging	Het
Olfr775	A	G	10: 129,250,594	E20G	probably benign	Het
Olfr794	A	T	10: 129,571,348	Q231L	probably damaging	Het
Olfr829	A	T	9: 18,857,486	Y287F	possibly damaging	Het
Osbpl7	C	A	11: 97,059,128	S378R	probably damaging	Het
Otof	A	T	5: 30,371,723	Y1775*	probably null	Het
Parp16	T	C	9: 65,215,594	S46P	possibly damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pi16	A	T	17: 29,319,387	Q58L	possibly damaging	Het
Pld3	C	A	7: 27,539,452	M190I	probably benign	Het
Plscr4	T	G	9: 92,490,046	I290S	probably damaging	Het
Ppip5k2	T	C	1: 97,723,806	D928G	possibly damaging	Het
Ppp1r13l	T	A	7: 19,368,611	L15Q	probably damaging	Het
Ptpn14	C	A	1: 189,839,502	S263R	possibly damaging	Het
Sema7a	G	A	9: 57,954,899	V178I	possibly damaging	Het
Sesn2	A	T	4: 132,497,070	Y342*	probably null	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Sltm	A	G	9: 70,543,032	N38S	possibly damaging	Het
Smg1	T	C	7: 118,154,622		probably benign	Het
Spsb1	A	T	4: 149,906,910	V67E	probably damaging	Het
Suox	A	G	10: 128,670,539	V540A	possibly damaging	Het
Tbc1d12	T	A	19: 38,911,085	I483N	probably damaging	Het
Tbcb	A	T	7: 30,224,499	D198E	possibly damaging	Het
Tbce	T	C	13: 14,019,709	K122E	probably benign	Het
Tcap	T	A	11: 98,384,379	L113H	probably damaging	Het
Thsd7a	A	T	6: 12,321,041	I1545N	probably damaging	Het
Tmed10	T	C	12: 85,374,503	T55A	possibly damaging	Het
Tmem268	T	A	4: 63,579,943	V200D	probably damaging	Het
Tmem45b	A	C	9: 31,431,355	I50M	probably damaging	Het
Trp53bp2	T	C	1: 182,458,903	W1103R	probably damaging	Het
Ttn	C	T	2: 76,764,033	V20524M	probably damaging	Het
Ulk2	A	T	11: 61,812,738	N379K	probably benign	Het
Vmn1r59	A	G	7: 5,454,554	V69A	probably benign	Het
Vmn2r10	A	T	5: 109,001,995	Y394*	probably null	Het
Zfp212	T	C	6: 47,931,541	S485P	probably benign	Het
Zfp512b	A	T	2: 181,585,735	C776S	probably damaging	Het
Zfp518b	A	G	5: 38,671,741	Y974H	probably damaging	Het

Other mutations in Nfatc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Nfatc1	APN	18	80667026	missense	probably damaging	1.00
IGL00742:Nfatc1	APN	18	80698014	missense	probably benign	0.20
IGL01510:Nfatc1	APN	18	80698188	missense	probably damaging	1.00
IGL01790:Nfatc1	APN	18	80667042	missense	probably damaging	1.00
IGL02548:Nfatc1	APN	18	80697898	missense	probably damaging	1.00
goldfeld	UTSW	18	80697832	missense	probably damaging	0.99
Instrumenten	UTSW	18	80682191	missense	probably damaging	0.98
Original	UTSW	18	80653564	splice site	probably null
BB003:Nfatc1	UTSW	18	80697666	missense	probably damaging	0.96
BB013:Nfatc1	UTSW	18	80697666	missense	probably damaging	0.96
R0019:Nfatc1	UTSW	18	80635504	missense	probably benign
R0411:Nfatc1	UTSW	18	80698042	missense	possibly damaging	0.88
R0738:Nfatc1	UTSW	18	80697910	missense	probably damaging	1.00
R0940:Nfatc1	UTSW	18	80635895	missense	probably benign	0.03
R1458:Nfatc1	UTSW	18	80665267	splice site	probably benign
R1622:Nfatc1	UTSW	18	80666967	missense	probably damaging	1.00
R2110:Nfatc1	UTSW	18	80635664	nonsense	probably null
R2112:Nfatc1	UTSW	18	80635664	nonsense	probably null
R2157:Nfatc1	UTSW	18	80635845	missense	possibly damaging	0.88
R3857:Nfatc1	UTSW	18	80665275	splice site	probably benign
R3859:Nfatc1	UTSW	18	80665275	splice site	probably benign
R4108:Nfatc1	UTSW	18	80698368	missense	possibly damaging	0.68
R4510:Nfatc1	UTSW	18	80635579	missense	probably damaging	0.96
R4511:Nfatc1	UTSW	18	80635579	missense	probably damaging	0.96
R4618:Nfatc1	UTSW	18	80697832	missense	probably damaging	0.99
R4850:Nfatc1	UTSW	18	80697865	missense	probably benign	0.30
R5329:Nfatc1	UTSW	18	80708117	start codon destroyed	probably null
R5395:Nfatc1	UTSW	18	80636020	missense	possibly damaging	0.80
R5468:Nfatc1	UTSW	18	80649855	missense	probably benign	0.00
R5522:Nfatc1	UTSW	18	80653529	missense	probably benign	0.36
R5568:Nfatc1	UTSW	18	80649822	missense	probably benign	0.12
R6111:Nfatc1	UTSW	18	80697910	missense	probably damaging	1.00
R6190:Nfatc1	UTSW	18	80712670	missense	probably benign	0.21
R6397:Nfatc1	UTSW	18	80635941	missense	probably damaging	1.00
R6943:Nfatc1	UTSW	18	80635555	missense	probably damaging	1.00
R6970:Nfatc1	UTSW	18	80667013	missense	probably benign	0.34
R6994:Nfatc1	UTSW	18	80653564	splice site	probably null
R7679:Nfatc1	UTSW	18	80607990	missense	probably benign
R7703:Nfatc1	UTSW	18	80682289	missense	probably damaging	1.00
R7926:Nfatc1	UTSW	18	80697666	missense	probably damaging	0.96
R8346:Nfatc1	UTSW	18	80682167	missense	probably benign	0.00
R8411:Nfatc1	UTSW	18	80667042	missense	probably damaging	1.00
R8480:Nfatc1	UTSW	18	80635644	missense	probably benign	0.15
R8669:Nfatc1	UTSW	18	80682191	missense	probably damaging	0.98
R8928:Nfatc1	UTSW	18	80697965	missense	possibly damaging	0.82
R9194:Nfatc1	UTSW	18	80708043	missense	probably benign	0.04
R9281:Nfatc1	UTSW	18	80697975	missense	probably damaging	1.00
R9517:Nfatc1	UTSW	18	80682191	missense	probably damaging	0.98
R9562:Nfatc1	UTSW	18	80635701	missense	probably damaging	1.00
R9636:Nfatc1	UTSW	18	80663396	missense	possibly damaging	0.50
X0062:Nfatc1	UTSW	18	80697618	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- CAACTCAATGGCTGTGCAC -3'
(R):5'- GTGGTCACCTTGGACTTCAG -3'

Sequencing Primer
(F):5'- AATGGCTGTGCACACACCG -3'
(R):5'- TTGGACTTCAGCCACCCG -3'

Posted On

2014-06-23