Incidental Mutation 'R1846:Olfr1258'
ID207701
Institutional Source Beutler Lab
Gene Symbol Olfr1258
Ensembl Gene ENSMUSG00000049149
Gene Nameolfactory receptor 1258
SynonymsGA_x6K02T2Q125-51361752-51362687, MOR232-3
MMRRC Submission 039871-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R1846 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89927309-89936334 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89930666 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 286 (T286A)
Ref Sequence ENSEMBL: ENSMUSP00000149547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102609] [ENSMUST00000111516] [ENSMUST00000213720]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102609
AA Change: T286A

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099669
Gene: ENSMUSG00000049149
AA Change: T286A

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 299 3.4e-5 PFAM
Pfam:7tm_1 39 285 6.4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111516
AA Change: T286A

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107141
Gene: ENSMUSG00000049149
AA Change: T286A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 33 299 3.4e-5 PFAM
Pfam:7tm_1 39 285 4.9e-32 PFAM
Pfam:7tm_4 137 278 2.7e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213720
AA Change: T286A

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik G T 14: 49,235,963 L102I probably damaging Het
2900092C05Rik G A 7: 12,512,882 R63Q probably benign Het
Adamts20 A T 15: 94,345,990 C619S probably damaging Het
Alx1 T C 10: 103,025,304 D121G possibly damaging Het
Anks3 A C 16: 4,953,884 M215R probably benign Het
Anxa4 T A 6: 86,741,911 probably null Het
Arhgef25 A G 10: 127,185,864 V222A probably damaging Het
Bglap2 A G 3: 88,378,625 probably benign Het
Cars2 A G 8: 11,514,674 V22A probably benign Het
Cenpe T A 3: 135,239,845 I1040N probably damaging Het
Cep170 C T 1: 176,755,769 D1015N probably damaging Het
Chia1 T A 3: 106,130,865 I359N probably damaging Het
Crot A T 5: 8,988,248 V93E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnmbp T C 19: 43,902,747 I194V probably damaging Het
Dock4 T A 12: 40,733,268 C734S probably benign Het
Eif4e3 T C 6: 99,640,701 S70G probably benign Het
Entpd3 G A 9: 120,558,375 D213N probably benign Het
Ern2 T G 7: 122,176,536 Y445S probably benign Het
Fasn A G 11: 120,813,307 S1429P probably benign Het
Fat4 A G 3: 38,982,383 I3395V probably benign Het
Fbln2 C A 6: 91,256,417 Q628K possibly damaging Het
Fbxo28 T C 1: 182,326,280 N164D probably benign Het
Fez1 T C 9: 36,867,767 S247P probably damaging Het
Gars A G 6: 55,063,168 D360G probably benign Het
Gcfc2 A T 6: 81,956,892 Q710L probably damaging Het
Ggt5 A G 10: 75,610,542 probably null Het
Glp1r A G 17: 30,929,935 probably null Het
Hspa14 T C 2: 3,491,660 D356G possibly damaging Het
Htt T A 5: 34,848,944 I1399N probably damaging Het
Kmt2e G A 5: 23,499,486 probably benign Het
Krt36 C A 11: 100,105,548 G17C probably damaging Het
Lama2 T C 10: 27,212,096 E895G probably damaging Het
Lamb2 G A 9: 108,487,387 R1142H probably benign Het
Lhcgr C T 17: 88,765,147 probably null Het
Lpin2 A G 17: 71,225,069 T140A probably benign Het
Metap1 A G 3: 138,480,682 probably benign Het
Mpeg1 T C 19: 12,463,122 V648A probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Muc4 T A 16: 32,752,369 I749N probably benign Het
N4bp2 T C 5: 65,808,519 F1304L probably damaging Het
Nup85 A G 11: 115,568,413 E114G probably benign Het
Olfr1415 A T 1: 92,491,100 Y218* probably null Het
Olfr448 A G 6: 42,897,320 S290G probably damaging Het
Pafah2 GCCCC GCCCCC 4: 134,425,541 probably null Het
Parp2 T A 14: 50,815,386 C145* probably null Het
Plpp6 T C 19: 28,964,280 S94P probably benign Het
Polr1a T C 6: 71,976,188 I1580T probably damaging Het
Polrmt A T 10: 79,738,209 V860E probably damaging Het
Ppp1r17 A G 6: 56,022,427 E15G possibly damaging Het
Prl7b1 A T 13: 27,602,848 W133R probably damaging Het
Ptk7 A G 17: 46,576,490 probably null Het
Rad23b C T 4: 55,383,637 Q290* probably null Het
Rorb C T 19: 18,955,081 E369K probably damaging Het
Rusc1 T C 3: 89,092,145 D110G probably damaging Het
Smg7 A G 1: 152,848,850 S527P probably damaging Het
Ssbp2 C T 13: 91,664,149 P105L probably damaging Het
Stt3a C T 9: 36,763,385 R34H probably damaging Het
Sufu T A 19: 46,450,947 I202N possibly damaging Het
Thsd7b G A 1: 129,613,256 R289Q probably damaging Het
Tph1 A T 7: 46,660,439 S130T probably damaging Het
Ttn A G 2: 76,945,686 S1671P probably damaging Het
Usp4 A G 9: 108,372,736 I441V probably benign Het
Vmn1r8 A G 6: 57,036,428 N155D probably benign Het
Vmn2r115 A C 17: 23,359,383 K610T probably damaging Het
Vmn2r62 G A 7: 42,789,122 P97S probably damaging Het
Zbtb40 T C 4: 137,007,839 D297G probably benign Het
Zfp174 C A 16: 3,854,735 Q383K probably benign Het
Zfp318 T A 17: 46,413,666 D2198E probably benign Het
Zfp628 C T 7: 4,920,867 P696L possibly damaging Het
Zgrf1 T A 3: 127,615,463 N1695K probably damaging Het
Other mutations in Olfr1258
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02386:Olfr1258 APN 2 89930544 missense probably damaging 0.96
IGL02552:Olfr1258 APN 2 89930559 missense probably benign 0.01
IGL03300:Olfr1258 APN 2 89930227 nonsense probably null
R0081:Olfr1258 UTSW 2 89930079 missense possibly damaging 0.90
R0197:Olfr1258 UTSW 2 89930201 missense probably benign 0.00
R0701:Olfr1258 UTSW 2 89930201 missense probably benign 0.00
R0883:Olfr1258 UTSW 2 89930201 missense probably benign 0.00
R1163:Olfr1258 UTSW 2 89930105 missense possibly damaging 0.78
R1833:Olfr1258 UTSW 2 89930301 nonsense probably null
R4504:Olfr1258 UTSW 2 89930351 missense possibly damaging 0.89
R4507:Olfr1258 UTSW 2 89930351 missense possibly damaging 0.89
R4679:Olfr1258 UTSW 2 89930664 missense possibly damaging 0.63
R4908:Olfr1258 UTSW 2 89930579 missense probably benign 0.00
R5430:Olfr1258 UTSW 2 89929913 missense probably benign 0.00
R6836:Olfr1258 UTSW 2 89930339 missense probably damaging 1.00
R7552:Olfr1258 UTSW 2 89930720 missense probably benign 0.06
R7709:Olfr1258 UTSW 2 89929881 missense probably benign 0.00
R8060:Olfr1258 UTSW 2 89930349 missense probably benign 0.04
Z1177:Olfr1258 UTSW 2 89930598 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCACATTCTGGGGCTCTTTG -3'
(R):5'- CTGGGTAACATTCTTGCTGGC -3'

Sequencing Primer
(F):5'- GTTCATTAAGAAACCACAGTGCAG -3'
(R):5'- CTTGCTGGCTTCAAATACAATGTC -3'
Posted On2014-06-23