Mutagenetix > Incidental Mutation

Incidental Mutation 'R1846:Cenpe'

207708

Institutional Source

Beutler Lab

Gene Symbol

Cenpe

Ensembl Gene

ENSMUSG00000045328

Gene Name

centromere protein E

Synonyms

312kDa, CENP-E, Kif10, N-7 kinesin

MMRRC Submission

039871-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1846 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135212537-135273611 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 135239845 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1040 (I1040N)

Ref Sequence

ENSEMBL: ENSMUSP00000057938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062893] [ENSMUST00000197369]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000062893
AA Change: I1040N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: I1040N

Domain	Start	End	E-Value	Type
KISc	4	337	2.4e-172	SMART
coiled coil region	493	612	N/A	INTRINSIC
coiled coil region	637	752	N/A	INTRINSIC
internal_repeat_1	768	801	3.5e-5	PROSPERO
coiled coil region	821	991	N/A	INTRINSIC
low complexity region	1119	1143	N/A	INTRINSIC
internal_repeat_2	1225	1238	6.26e-5	PROSPERO
low complexity region	1446	1467	N/A	INTRINSIC
low complexity region	1480	1498	N/A	INTRINSIC
internal_repeat_2	1614	1627	6.26e-5	PROSPERO
internal_repeat_1	2018	2051	3.5e-5	PROSPERO
coiled coil region	2226	2247	N/A	INTRINSIC
coiled coil region	2316	2363	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197369

SMART Domains

Protein: ENSMUSP00000143435
Gene: ENSMUSG00000045328

Domain	Start	End	E-Value	Type
coiled coil region	2	49	N/A	INTRINSIC
coiled coil region	85	172	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.6%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011H14Rik	G	T	14: 49,235,963	L102I	probably damaging	Het
2900092C05Rik	G	A	7: 12,512,882	R63Q	probably benign	Het
Adamts20	A	T	15: 94,345,990	C619S	probably damaging	Het
Alx1	T	C	10: 103,025,304	D121G	possibly damaging	Het
Anks3	A	C	16: 4,953,884	M215R	probably benign	Het
Anxa4	T	A	6: 86,741,911		probably null	Het
Arhgef25	A	G	10: 127,185,864	V222A	probably damaging	Het
Bglap2	A	G	3: 88,378,625		probably benign	Het
Cars2	A	G	8: 11,514,674	V22A	probably benign	Het
Cep170	C	T	1: 176,755,769	D1015N	probably damaging	Het
Chia1	T	A	3: 106,130,865	I359N	probably damaging	Het
Crot	A	T	5: 8,988,248	V93E	probably benign	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dnmbp	T	C	19: 43,902,747	I194V	probably damaging	Het
Dock4	T	A	12: 40,733,268	C734S	probably benign	Het
Eif4e3	T	C	6: 99,640,701	S70G	probably benign	Het
Entpd3	G	A	9: 120,558,375	D213N	probably benign	Het
Ern2	T	G	7: 122,176,536	Y445S	probably benign	Het
Fasn	A	G	11: 120,813,307	S1429P	probably benign	Het
Fat4	A	G	3: 38,982,383	I3395V	probably benign	Het
Fbln2	C	A	6: 91,256,417	Q628K	possibly damaging	Het
Fbxo28	T	C	1: 182,326,280	N164D	probably benign	Het
Fez1	T	C	9: 36,867,767	S247P	probably damaging	Het
Gars	A	G	6: 55,063,168	D360G	probably benign	Het
Gcfc2	A	T	6: 81,956,892	Q710L	probably damaging	Het
Ggt5	A	G	10: 75,610,542		probably null	Het
Glp1r	A	G	17: 30,929,935		probably null	Het
Hspa14	T	C	2: 3,491,660	D356G	possibly damaging	Het
Htt	T	A	5: 34,848,944	I1399N	probably damaging	Het
Kmt2e	G	A	5: 23,499,486		probably benign	Het
Krt36	C	A	11: 100,105,548	G17C	probably damaging	Het
Lama2	T	C	10: 27,212,096	E895G	probably damaging	Het
Lamb2	G	A	9: 108,487,387	R1142H	probably benign	Het
Lhcgr	C	T	17: 88,765,147		probably null	Het
Lpin2	A	G	17: 71,225,069	T140A	probably benign	Het
Metap1	A	G	3: 138,480,682		probably benign	Het
Mpeg1	T	C	19: 12,463,122	V648A	probably benign	Het
Mroh2a	A	G	1: 88,258,664	S64G	probably benign	Het
Muc4	T	A	16: 32,752,369	I749N	probably benign	Het
N4bp2	T	C	5: 65,808,519	F1304L	probably damaging	Het
Nup85	A	G	11: 115,568,413	E114G	probably benign	Het
Olfr1258	A	G	2: 89,930,666	T286A	possibly damaging	Het
Olfr1415	A	T	1: 92,491,100	Y218*	probably null	Het
Olfr448	A	G	6: 42,897,320	S290G	probably damaging	Het
Pafah2	GCCCC	GCCCCC	4: 134,425,541		probably null	Het
Parp2	T	A	14: 50,815,386	C145*	probably null	Het
Plpp6	T	C	19: 28,964,280	S94P	probably benign	Het
Polr1a	T	C	6: 71,976,188	I1580T	probably damaging	Het
Polrmt	A	T	10: 79,738,209	V860E	probably damaging	Het
Ppp1r17	A	G	6: 56,022,427	E15G	possibly damaging	Het
Prl7b1	A	T	13: 27,602,848	W133R	probably damaging	Het
Ptk7	A	G	17: 46,576,490		probably null	Het
Rad23b	C	T	4: 55,383,637	Q290*	probably null	Het
Rorb	C	T	19: 18,955,081	E369K	probably damaging	Het
Rusc1	T	C	3: 89,092,145	D110G	probably damaging	Het
Smg7	A	G	1: 152,848,850	S527P	probably damaging	Het
Ssbp2	C	T	13: 91,664,149	P105L	probably damaging	Het
Stt3a	C	T	9: 36,763,385	R34H	probably damaging	Het
Sufu	T	A	19: 46,450,947	I202N	possibly damaging	Het
Thsd7b	G	A	1: 129,613,256	R289Q	probably damaging	Het
Tph1	A	T	7: 46,660,439	S130T	probably damaging	Het
Ttn	A	G	2: 76,945,686	S1671P	probably damaging	Het
Usp4	A	G	9: 108,372,736	I441V	probably benign	Het
Vmn1r8	A	G	6: 57,036,428	N155D	probably benign	Het
Vmn2r115	A	C	17: 23,359,383	K610T	probably damaging	Het
Vmn2r62	G	A	7: 42,789,122	P97S	probably damaging	Het
Zbtb40	T	C	4: 137,007,839	D297G	probably benign	Het
Zfp174	C	A	16: 3,854,735	Q383K	probably benign	Het
Zfp318	T	A	17: 46,413,666	D2198E	probably benign	Het
Zfp628	C	T	7: 4,920,867	P696L	possibly damaging	Het
Zgrf1	T	A	3: 127,615,463	N1695K	probably damaging	Het

Other mutations in Cenpe

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00655:Cenpe	APN	3	135231455	critical splice donor site	probably null
IGL00799:Cenpe	APN	3	135228917	critical splice donor site	probably null
IGL00815:Cenpe	APN	3	135259351	missense	probably benign
IGL01446:Cenpe	APN	3	135237539	missense	probably benign	0.01
IGL01469:Cenpe	APN	3	135228806	missense	probably damaging	1.00
IGL01843:Cenpe	APN	3	135218507	missense	possibly damaging	0.88
IGL02254:Cenpe	APN	3	135255477	missense	probably benign
IGL02337:Cenpe	APN	3	135220276	splice site	probably benign
IGL02382:Cenpe	APN	3	135247386	missense	probably benign
IGL02458:Cenpe	APN	3	135230108	nonsense	probably null
IGL02934:Cenpe	APN	3	135264351	missense	probably damaging	1.00
IGL03335:Cenpe	APN	3	135243625	missense	probably benign
R0086:Cenpe	UTSW	3	135264424	splice site	probably benign
R0173:Cenpe	UTSW	3	135259983	missense	probably benign	0.00
R0394:Cenpe	UTSW	3	135216425	splice site	probably benign
R0411:Cenpe	UTSW	3	135222255	missense	probably damaging	1.00
R0624:Cenpe	UTSW	3	135246586	missense	probably benign	0.00
R0634:Cenpe	UTSW	3	135246827	missense	probably damaging	1.00
R0648:Cenpe	UTSW	3	135230082	missense	probably damaging	1.00
R0691:Cenpe	UTSW	3	135217305	missense	probably damaging	1.00
R1184:Cenpe	UTSW	3	135264422	critical splice donor site	probably null
R1530:Cenpe	UTSW	3	135246902	missense	possibly damaging	0.92
R1559:Cenpe	UTSW	3	135270900	missense	probably benign	0.07
R1562:Cenpe	UTSW	3	135238394	missense	possibly damaging	0.53
R1568:Cenpe	UTSW	3	135239758	missense	probably benign	0.01
R1712:Cenpe	UTSW	3	135265933	missense	probably damaging	0.99
R1828:Cenpe	UTSW	3	135246496	missense	probably damaging	0.99
R1861:Cenpe	UTSW	3	135268979	missense	probably damaging	1.00
R1938:Cenpe	UTSW	3	135247479	missense	probably damaging	0.98
R1961:Cenpe	UTSW	3	135242493	missense	probably damaging	1.00
R2062:Cenpe	UTSW	3	135222321	splice site	probably benign
R2118:Cenpe	UTSW	3	135246884	missense	possibly damaging	0.94
R2127:Cenpe	UTSW	3	135239780	missense	probably benign	0.08
R2156:Cenpe	UTSW	3	135247474	missense	probably benign	0.34
R2265:Cenpe	UTSW	3	135261636	missense	probably benign	0.02
R2268:Cenpe	UTSW	3	135261636	missense	probably benign	0.02
R2392:Cenpe	UTSW	3	135248113	missense	probably damaging	1.00
R2508:Cenpe	UTSW	3	135241073	missense	possibly damaging	0.92
R3084:Cenpe	UTSW	3	135241021	missense	probably damaging	1.00
R3779:Cenpe	UTSW	3	135256576	missense	possibly damaging	0.87
R3833:Cenpe	UTSW	3	135222322	splice site	probably benign
R3974:Cenpe	UTSW	3	135235225	splice site	probably null
R3975:Cenpe	UTSW	3	135235225	splice site	probably null
R3975:Cenpe	UTSW	3	135238472	critical splice donor site	probably null
R4151:Cenpe	UTSW	3	135215153	missense	probably benign	0.36
R4166:Cenpe	UTSW	3	135243718	missense	probably damaging	1.00
R4581:Cenpe	UTSW	3	135247000	missense	probably benign	0.30
R4622:Cenpe	UTSW	3	135243708	missense	probably benign	0.22
R4692:Cenpe	UTSW	3	135216379	missense	probably benign	0.29
R4769:Cenpe	UTSW	3	135248151	missense	probably benign
R4976:Cenpe	UTSW	3	135234876	missense	probably damaging	1.00
R4983:Cenpe	UTSW	3	135234928	missense	probably damaging	1.00
R4990:Cenpe	UTSW	3	135256640	missense	probably damaging	1.00
R5002:Cenpe	UTSW	3	135247081	missense	probably benign
R5057:Cenpe	UTSW	3	135220313	missense	probably benign	0.14
R5063:Cenpe	UTSW	3	135270954	missense	probably damaging	0.99
R5181:Cenpe	UTSW	3	135242303	missense	probably damaging	0.99
R5281:Cenpe	UTSW	3	135230150	missense	possibly damaging	0.89
R5389:Cenpe	UTSW	3	135259388	critical splice donor site	probably null
R5517:Cenpe	UTSW	3	135223265	missense	probably damaging	1.00
R5521:Cenpe	UTSW	3	135269065	missense	probably damaging	1.00
R5607:Cenpe	UTSW	3	135235076	nonsense	probably null
R5608:Cenpe	UTSW	3	135235076	nonsense	probably null
R5627:Cenpe	UTSW	3	135235473	missense	possibly damaging	0.51
R5766:Cenpe	UTSW	3	135248413	missense	probably damaging	0.96
R5783:Cenpe	UTSW	3	135261580	missense	probably benign	0.00
R5933:Cenpe	UTSW	3	135261628	missense	probably benign	0.03
R6073:Cenpe	UTSW	3	135260073	nonsense	probably null
R6163:Cenpe	UTSW	3	135269003	missense	probably damaging	0.99
R6192:Cenpe	UTSW	3	135248530	missense	possibly damaging	0.93
R6224:Cenpe	UTSW	3	135243775	missense	possibly damaging	0.87
R6313:Cenpe	UTSW	3	135230175	missense	probably benign	0.26
R6326:Cenpe	UTSW	3	135239778	missense	probably benign	0.15
R6383:Cenpe	UTSW	3	135251528	missense	probably damaging	1.00
R6418:Cenpe	UTSW	3	135251544	missense	probably damaging	0.99
R6797:Cenpe	UTSW	3	135238138	missense	possibly damaging	0.92
R6810:Cenpe	UTSW	3	135243822	missense	probably benign	0.00
R6989:Cenpe	UTSW	3	135235127	missense	probably damaging	1.00
R7009:Cenpe	UTSW	3	135235201	missense	probably damaging	0.97
R7009:Cenpe	UTSW	3	135235202	missense	probably benign	0.02
R7039:Cenpe	UTSW	3	135255456	missense	probably benign	0.28
R7387:Cenpe	UTSW	3	135247037	missense	probably benign	0.05
R7470:Cenpe	UTSW	3	135242155	missense	probably damaging	1.00
R7535:Cenpe	UTSW	3	135243762	missense	possibly damaging	0.90
R7562:Cenpe	UTSW	3	135248634	missense	probably damaging	1.00
R7573:Cenpe	UTSW	3	135247459	missense	probably damaging	1.00
R7613:Cenpe	UTSW	3	135242302	missense	possibly damaging	0.90
R7741:Cenpe	UTSW	3	135247335	splice site	probably null
R7771:Cenpe	UTSW	3	135240941	splice site	probably null
R7843:Cenpe	UTSW	3	135232959	nonsense	probably null
R7973:Cenpe	UTSW	3	135223250	missense	probably damaging	1.00
R8036:Cenpe	UTSW	3	135239848	frame shift	probably null
R8069:Cenpe	UTSW	3	135243718	missense	probably damaging	1.00
R8151:Cenpe	UTSW	3	135247022	missense	probably benign	0.28
R8176:Cenpe	UTSW	3	135230090	missense	probably damaging	1.00
R8191:Cenpe	UTSW	3	135251614	missense	probably benign
R8251:Cenpe	UTSW	3	135251684	critical splice donor site	probably null
R8425:Cenpe	UTSW	3	135242627	nonsense	probably null
R8488:Cenpe	UTSW	3	135259241	missense	probably damaging	1.00
R8811:Cenpe	UTSW	3	135223240	missense	probably damaging	1.00
R8850:Cenpe	UTSW	3	135225016	missense	probably damaging	1.00
R8879:Cenpe	UTSW	3	135260101	missense	probably damaging	0.99
R8899:Cenpe	UTSW	3	135239883	missense	probably benign	0.18
R9035:Cenpe	UTSW	3	135270811	missense	probably benign	0.01
R9038:Cenpe	UTSW	3	135218036	missense	probably benign	0.00
R9093:Cenpe	UTSW	3	135239880	nonsense	probably null
R9221:Cenpe	UTSW	3	135230078	missense	possibly damaging	0.90
R9365:Cenpe	UTSW	3	135248446	missense	possibly damaging	0.56
R9443:Cenpe	UTSW	3	135270848	missense	probably damaging	0.99
Z1177:Cenpe	UTSW	3	135216385	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- ACTTCTGGCCAGTGAACAGG -3'
(R):5'- AGTTCTAACTTAGGCAGAGACATCTG -3'

Sequencing Primer
(F):5'- GAACCCAAAGCTAGCTGTCTGTATG -3'
(R):5'- GACATCTGTCAAGTCATATAACCATC -3'

Posted On

2014-06-23