Mutagenetix > Incidental Mutation

Incidental Mutation 'R1846:Rad23b'

207710

Institutional Source

Beutler Lab

Gene Symbol

Rad23b

Ensembl Gene

ENSMUSG00000028426

Gene Name

RAD23 homolog B, nucleotide excision repair protein

Synonyms

mHR23B, 0610007D13Rik

MMRRC Submission

039871-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1846 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55350043-55392237 bp(+) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 55383637 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 290 (Q290*)

Ref Sequence

ENSEMBL: ENSMUSP00000030134 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030134]

AlphaFold

P54728

PDB Structure

The Mouse PNGase-HR23 Complex Reveals a Complete Remodulation of the Protein-Protein Interface Compared to its Yeast Orthologs [X-RAY DIFFRACTION]
The Mouse PNGase-HR23 Complex Reveals a Complete Remodulation of the Protein-Protein Interface Compared to its Yeast Orthologs [X-RAY DIFFRACTION]

Predicted Effect

probably null
Transcript: ENSMUST00000030134
AA Change: Q290*

SMART Domains

Protein: ENSMUSP00000030134
Gene: ENSMUSG00000028426
AA Change: Q290*

Domain	Start	End	E-Value	Type
UBQ	1	75	8.79e-24	SMART
low complexity region	79	143	N/A	INTRINSIC
UBA	190	227	3.1e-11	SMART
low complexity region	257	270	N/A	INTRINSIC
STI1	274	317	3.37e-10	SMART
UBA	373	410	6.35e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156263

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.6%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in the nucleotide excision repair (NER). This protein was found to be a component of the protein complex that specifically complements the NER defect of xeroderma pigmentosum group C (XP-c) cell extracts in vitro. This protein was also shown to interact with, and elevate the nucleotide excision activity of 3-methyladenine-DNA glycosylase (MPG), which suggested a role in DNA damage recognition in base excision repair. This protein contains an N-terminal ubiquitin-like domain, which was reported to interact with 26S proteasome, and thus this protein may be involved in the ubiquitin mediated proteolytic pathway in cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a disruption in this gene usually die around the time of birth. Those that survive show growth retardation, eye, reproductive, behavioral, and digestive system abnormalities. They usually die within 1 year of birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900092C05Rik	G	A	7: 12,246,809 (GRCm39)	R63Q	probably benign	Het
Adamts20	A	T	15: 94,243,871 (GRCm39)	C619S	probably damaging	Het
Alx1	T	C	10: 102,861,165 (GRCm39)	D121G	possibly damaging	Het
Anks3	A	C	16: 4,771,748 (GRCm39)	M215R	probably benign	Het
Anxa4	T	A	6: 86,718,893 (GRCm39)		probably null	Het
Arhgef25	A	G	10: 127,021,733 (GRCm39)	V222A	probably damaging	Het
Bglap2	A	G	3: 88,285,932 (GRCm39)		probably benign	Het
Cars2	A	G	8: 11,564,674 (GRCm39)	V22A	probably benign	Het
Ccdc198	G	T	14: 49,473,420 (GRCm39)	L102I	probably damaging	Het
Cenpe	T	A	3: 134,945,606 (GRCm39)	I1040N	probably damaging	Het
Cep170	C	T	1: 176,583,335 (GRCm39)	D1015N	probably damaging	Het
Chia1	T	A	3: 106,038,181 (GRCm39)	I359N	probably damaging	Het
Crot	A	T	5: 9,038,248 (GRCm39)	V93E	probably benign	Het
Dab1	C	T	4: 104,588,948 (GRCm39)	A524V	probably benign	Het
Dnmbp	T	C	19: 43,891,186 (GRCm39)	I194V	probably damaging	Het
Dock4	T	A	12: 40,783,267 (GRCm39)	C734S	probably benign	Het
Eif4e3	T	C	6: 99,617,662 (GRCm39)	S70G	probably benign	Het
Entpd3	G	A	9: 120,387,441 (GRCm39)	D213N	probably benign	Het
Ern2	T	G	7: 121,775,759 (GRCm39)	Y445S	probably benign	Het
Fasn	A	G	11: 120,704,133 (GRCm39)	S1429P	probably benign	Het
Fat4	A	G	3: 39,036,532 (GRCm39)	I3395V	probably benign	Het
Fbln2	C	A	6: 91,233,399 (GRCm39)	Q628K	possibly damaging	Het
Fbxo28	T	C	1: 182,153,845 (GRCm39)	N164D	probably benign	Het
Fez1	T	C	9: 36,779,063 (GRCm39)	S247P	probably damaging	Het
Gars1	A	G	6: 55,040,153 (GRCm39)	D360G	probably benign	Het
Gcfc2	A	T	6: 81,933,873 (GRCm39)	Q710L	probably damaging	Het
Ggt5	A	G	10: 75,446,376 (GRCm39)		probably null	Het
Glp1r	A	G	17: 31,148,909 (GRCm39)		probably null	Het
Hspa14	T	C	2: 3,492,697 (GRCm39)	D356G	possibly damaging	Het
Htt	T	A	5: 35,006,288 (GRCm39)	I1399N	probably damaging	Het
Kmt2e	G	A	5: 23,704,484 (GRCm39)		probably benign	Het
Krt36	C	A	11: 99,996,374 (GRCm39)	G17C	probably damaging	Het
Lama2	T	C	10: 27,088,092 (GRCm39)	E895G	probably damaging	Het
Lamb2	G	A	9: 108,364,586 (GRCm39)	R1142H	probably benign	Het
Lhcgr	C	T	17: 89,072,575 (GRCm39)		probably null	Het
Lpin2	A	G	17: 71,532,064 (GRCm39)	T140A	probably benign	Het
Metap1	A	G	3: 138,186,443 (GRCm39)		probably benign	Het
Mpeg1	T	C	19: 12,440,486 (GRCm39)	V648A	probably benign	Het
Mroh2a	A	G	1: 88,186,386 (GRCm39)	S64G	probably benign	Het
Muc4	T	A	16: 32,752,369 (GRCm38)	I749N	probably benign	Het
N4bp2	T	C	5: 65,965,862 (GRCm39)	F1304L	probably damaging	Het
Nup85	A	G	11: 115,459,239 (GRCm39)	E114G	probably benign	Het
Or2a5	A	G	6: 42,874,254 (GRCm39)	S290G	probably damaging	Het
Or4c10	A	G	2: 89,761,010 (GRCm39)	T286A	possibly damaging	Het
Or6b2b	A	T	1: 92,418,822 (GRCm39)	Y218*	probably null	Het
Pafah2	GCCCC	GCCCCC	4: 134,152,852 (GRCm39)		probably null	Het
Parp2	T	A	14: 51,052,843 (GRCm39)	C145*	probably null	Het
Plpp6	T	C	19: 28,941,680 (GRCm39)	S94P	probably benign	Het
Polr1a	T	C	6: 71,953,172 (GRCm39)	I1580T	probably damaging	Het
Polrmt	A	T	10: 79,574,043 (GRCm39)	V860E	probably damaging	Het
Ppp1r17	A	G	6: 55,999,412 (GRCm39)	E15G	possibly damaging	Het
Prl7b1	A	T	13: 27,786,831 (GRCm39)	W133R	probably damaging	Het
Ptk7	A	G	17: 46,887,416 (GRCm39)		probably null	Het
Rorb	C	T	19: 18,932,445 (GRCm39)	E369K	probably damaging	Het
Rusc1	T	C	3: 88,999,452 (GRCm39)	D110G	probably damaging	Het
Smg7	A	G	1: 152,724,601 (GRCm39)	S527P	probably damaging	Het
Ssbp2	C	T	13: 91,812,268 (GRCm39)	P105L	probably damaging	Het
Stt3a	C	T	9: 36,674,681 (GRCm39)	R34H	probably damaging	Het
Sufu	T	A	19: 46,439,386 (GRCm39)	I202N	possibly damaging	Het
Thsd7b	G	A	1: 129,540,993 (GRCm39)	R289Q	probably damaging	Het
Tph1	A	T	7: 46,309,863 (GRCm39)	S130T	probably damaging	Het
Ttn	A	G	2: 76,776,030 (GRCm39)	S1671P	probably damaging	Het
Usp4	A	G	9: 108,249,935 (GRCm39)	I441V	probably benign	Het
Vmn1r8	A	G	6: 57,013,413 (GRCm39)	N155D	probably benign	Het
Vmn2r115	A	C	17: 23,578,357 (GRCm39)	K610T	probably damaging	Het
Vmn2r62	G	A	7: 42,438,546 (GRCm39)	P97S	probably damaging	Het
Zbtb40	T	C	4: 136,735,150 (GRCm39)	D297G	probably benign	Het
Zfp174	C	A	16: 3,672,599 (GRCm39)	Q383K	probably benign	Het
Zfp318	T	A	17: 46,724,592 (GRCm39)	D2198E	probably benign	Het
Zfp628	C	T	7: 4,923,866 (GRCm39)	P696L	possibly damaging	Het
Zgrf1	T	A	3: 127,409,112 (GRCm39)	N1695K	probably damaging	Het

Other mutations in Rad23b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01301:Rad23b	APN	4	55,366,774 (GRCm39)	splice site	probably benign
IGL01326:Rad23b	APN	4	55,383,601 (GRCm39)	missense	possibly damaging	0.95
IGL02398:Rad23b	APN	4	55,350,360 (GRCm39)	utr 5 prime	probably benign
IGL02506:Rad23b	APN	4	55,382,511 (GRCm39)	missense	probably benign	0.01
IGL02538:Rad23b	APN	4	55,370,457 (GRCm39)	missense	possibly damaging	0.67
Saguaro	UTSW	4	55,370,474 (GRCm39)	critical splice donor site	probably null
R0278:Rad23b	UTSW	4	55,383,575 (GRCm39)	splice site	probably null
R2198:Rad23b	UTSW	4	55,385,497 (GRCm39)	missense	possibly damaging	0.68
R2425:Rad23b	UTSW	4	55,385,438 (GRCm39)	missense	probably damaging	0.99
R3774:Rad23b	UTSW	4	55,382,589 (GRCm39)	missense	possibly damaging	0.95
R3781:Rad23b	UTSW	4	55,382,586 (GRCm39)	missense	probably damaging	1.00
R4197:Rad23b	UTSW	4	55,385,455 (GRCm39)	missense	probably damaging	0.98
R5911:Rad23b	UTSW	4	55,370,474 (GRCm39)	critical splice donor site	probably null
R6056:Rad23b	UTSW	4	55,382,540 (GRCm39)	missense	probably benign	0.01
R6067:Rad23b	UTSW	4	55,370,400 (GRCm39)	missense	probably damaging	0.97
R6078:Rad23b	UTSW	4	55,370,400 (GRCm39)	missense	probably damaging	0.97
R6079:Rad23b	UTSW	4	55,370,400 (GRCm39)	missense	probably damaging	0.97
R7426:Rad23b	UTSW	4	55,370,469 (GRCm39)	missense	probably benign	0.00
U15987:Rad23b	UTSW	4	55,370,400 (GRCm39)	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- AGCAGGCACATTGGGGTTTG -3'
(R):5'- ACCTATGTAAGCTGATCAATCGTTC -3'

Sequencing Primer
(F):5'- AGTTTGTGACTTGCTTTCTCTATAAC -3'
(R):5'- GTAAGCTGATCAATCGTTCTATCTC -3'

Posted On

2014-06-23