Incidental Mutation 'R1846:N4bp2'
ID207718
Institutional Source Beutler Lab
Gene Symbol N4bp2
Ensembl Gene ENSMUSG00000037795
Gene NameNEDD4 binding protein 2
SynonymsB3bp, LOC333789, LOC386488
MMRRC Submission 039871-MU
Accession Numbers

Genbank: NM_001024917.1; Ensembl: ENSMUST00000113738

Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R1846 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location65763521-65830108 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65808519 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1304 (F1304L)
Ref Sequence ENSEMBL: ENSMUSP00000144278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087264] [ENSMUST00000201489] [ENSMUST00000201615]
Predicted Effect probably damaging
Transcript: ENSMUST00000087264
AA Change: F1304L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084519
Gene: ENSMUSG00000037795
AA Change: F1304L

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1.1e-15 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 1e-9 BLAST
low complexity region 1496 1511 N/A INTRINSIC
DUF1771 1526 1591 1.88e-21 SMART
SMR 1596 1678 1.09e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113738
AA Change: F1304L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109367
Gene: ENSMUSG00000037795
AA Change: F1304L

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1e-14 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 1e-9 BLAST
low complexity region 1496 1511 N/A INTRINSIC
DUF1771 1526 1591 1.88e-21 SMART
SMR 1596 1678 1.09e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200843
Predicted Effect probably damaging
Transcript: ENSMUST00000201489
AA Change: F1304L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143807
Gene: ENSMUSG00000037795
AA Change: F1304L

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1e-14 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 1e-9 BLAST
low complexity region 1496 1511 N/A INTRINSIC
DUF1771 1526 1591 1.88e-21 SMART
SMR 1596 1678 1.09e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201615
AA Change: F1304L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144278
Gene: ENSMUSG00000037795
AA Change: F1304L

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1.2e-14 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 8e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202411
Meta Mutation Damage Score 0.2094 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a polynucleotide kinase domain (PNK) near the N-terminal region, and a Small MutS Related (Smr) domain near the C-terminal region. The encoded protein can bind to both B-cell leukemia/lymphoma 3 (BCL-3) and neural precursor cell expressed, developmentally downregulated 4, (Nedd4) proteins. This protein binds and hydrolyzes ATP, may function as a 5'-polynucleotide kinase, and has the capacity to be a ubiquitylation substrate. This protein may play a role in transcription-coupled DNA repair or genetic recombination. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik G T 14: 49,235,963 L102I probably damaging Het
2900092C05Rik G A 7: 12,512,882 R63Q probably benign Het
Adamts20 A T 15: 94,345,990 C619S probably damaging Het
Alx1 T C 10: 103,025,304 D121G possibly damaging Het
Anks3 A C 16: 4,953,884 M215R probably benign Het
Anxa4 T A 6: 86,741,911 probably null Het
Arhgef25 A G 10: 127,185,864 V222A probably damaging Het
Bglap2 A G 3: 88,378,625 probably benign Het
Cars2 A G 8: 11,514,674 V22A probably benign Het
Cenpe T A 3: 135,239,845 I1040N probably damaging Het
Cep170 C T 1: 176,755,769 D1015N probably damaging Het
Chia1 T A 3: 106,130,865 I359N probably damaging Het
Crot A T 5: 8,988,248 V93E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnmbp T C 19: 43,902,747 I194V probably damaging Het
Dock4 T A 12: 40,733,268 C734S probably benign Het
Eif4e3 T C 6: 99,640,701 S70G probably benign Het
Entpd3 G A 9: 120,558,375 D213N probably benign Het
Ern2 T G 7: 122,176,536 Y445S probably benign Het
Fasn A G 11: 120,813,307 S1429P probably benign Het
Fat4 A G 3: 38,982,383 I3395V probably benign Het
Fbln2 C A 6: 91,256,417 Q628K possibly damaging Het
Fbxo28 T C 1: 182,326,280 N164D probably benign Het
Fez1 T C 9: 36,867,767 S247P probably damaging Het
Gars A G 6: 55,063,168 D360G probably benign Het
Gcfc2 A T 6: 81,956,892 Q710L probably damaging Het
Ggt5 A G 10: 75,610,542 probably null Het
Glp1r A G 17: 30,929,935 probably null Het
Hspa14 T C 2: 3,491,660 D356G possibly damaging Het
Htt T A 5: 34,848,944 I1399N probably damaging Het
Kmt2e G A 5: 23,499,486 probably benign Het
Krt36 C A 11: 100,105,548 G17C probably damaging Het
Lama2 T C 10: 27,212,096 E895G probably damaging Het
Lamb2 G A 9: 108,487,387 R1142H probably benign Het
Lhcgr C T 17: 88,765,147 probably null Het
Lpin2 A G 17: 71,225,069 T140A probably benign Het
Metap1 A G 3: 138,480,682 probably benign Het
Mpeg1 T C 19: 12,463,122 V648A probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Muc4 T A 16: 32,752,369 I749N probably benign Het
Nup85 A G 11: 115,568,413 E114G probably benign Het
Olfr1258 A G 2: 89,930,666 T286A possibly damaging Het
Olfr1415 A T 1: 92,491,100 Y218* probably null Het
Olfr448 A G 6: 42,897,320 S290G probably damaging Het
Pafah2 GCCCC GCCCCC 4: 134,425,541 probably null Het
Parp2 T A 14: 50,815,386 C145* probably null Het
Plpp6 T C 19: 28,964,280 S94P probably benign Het
Polr1a T C 6: 71,976,188 I1580T probably damaging Het
Polrmt A T 10: 79,738,209 V860E probably damaging Het
Ppp1r17 A G 6: 56,022,427 E15G possibly damaging Het
Prl7b1 A T 13: 27,602,848 W133R probably damaging Het
Ptk7 A G 17: 46,576,490 probably null Het
Rad23b C T 4: 55,383,637 Q290* probably null Het
Rorb C T 19: 18,955,081 E369K probably damaging Het
Rusc1 T C 3: 89,092,145 D110G probably damaging Het
Smg7 A G 1: 152,848,850 S527P probably damaging Het
Ssbp2 C T 13: 91,664,149 P105L probably damaging Het
Stt3a C T 9: 36,763,385 R34H probably damaging Het
Sufu T A 19: 46,450,947 I202N possibly damaging Het
Thsd7b G A 1: 129,613,256 R289Q probably damaging Het
Tph1 A T 7: 46,660,439 S130T probably damaging Het
Ttn A G 2: 76,945,686 S1671P probably damaging Het
Usp4 A G 9: 108,372,736 I441V probably benign Het
Vmn1r8 A G 6: 57,036,428 N155D probably benign Het
Vmn2r115 A C 17: 23,359,383 K610T probably damaging Het
Vmn2r62 G A 7: 42,789,122 P97S probably damaging Het
Zbtb40 T C 4: 137,007,839 D297G probably benign Het
Zfp174 C A 16: 3,854,735 Q383K probably benign Het
Zfp318 T A 17: 46,413,666 D2198E probably benign Het
Zfp628 C T 7: 4,920,867 P696L possibly damaging Het
Zgrf1 T A 3: 127,615,463 N1695K probably damaging Het
Other mutations in N4bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:N4bp2 APN 5 65807524 missense probably damaging 0.96
IGL01503:N4bp2 APN 5 65803547 nonsense probably null 0.00
IGL01621:N4bp2 APN 5 65790924 missense probably damaging 1.00
IGL02109:N4bp2 APN 5 65798134 missense probably damaging 1.00
IGL02286:N4bp2 APN 5 65803552 missense probably damaging 1.00
1mM(1):N4bp2 UTSW 5 65807677 missense probably damaging 1.00
IGL03046:N4bp2 UTSW 5 65790960 missense probably damaging 1.00
R0164:N4bp2 UTSW 5 65803573 splice site probably benign
R0285:N4bp2 UTSW 5 65806559 missense probably benign 0.00
R0366:N4bp2 UTSW 5 65806396 missense possibly damaging 0.95
R0548:N4bp2 UTSW 5 65808153 missense probably benign 0.39
R0551:N4bp2 UTSW 5 65820341 splice site probably null
R0671:N4bp2 UTSW 5 65807437 missense probably damaging 0.99
R1136:N4bp2 UTSW 5 65808472 missense probably damaging 1.00
R1515:N4bp2 UTSW 5 65790498 missense probably benign 0.01
R1597:N4bp2 UTSW 5 65807140 missense probably benign 0.45
R1628:N4bp2 UTSW 5 65803572 splice site probably null
R1722:N4bp2 UTSW 5 65806882 missense probably benign 0.08
R1735:N4bp2 UTSW 5 65808316 missense probably damaging 1.00
R1745:N4bp2 UTSW 5 65790822 missense probably benign 0.12
R1759:N4bp2 UTSW 5 65826613 missense probably damaging 1.00
R1799:N4bp2 UTSW 5 65806825 missense possibly damaging 0.62
R1872:N4bp2 UTSW 5 65794518 splice site probably benign
R2042:N4bp2 UTSW 5 65826621 missense probably damaging 1.00
R2082:N4bp2 UTSW 5 65807565 missense probably damaging 1.00
R2101:N4bp2 UTSW 5 65790881 missense probably damaging 1.00
R2147:N4bp2 UTSW 5 65809200 missense probably damaging 1.00
R2251:N4bp2 UTSW 5 65806728 missense probably damaging 1.00
R2507:N4bp2 UTSW 5 65790061 missense probably benign 0.01
R2508:N4bp2 UTSW 5 65790061 missense probably benign 0.01
R2919:N4bp2 UTSW 5 65807098 missense probably benign 0.22
R3086:N4bp2 UTSW 5 65791053 missense probably damaging 1.00
R4092:N4bp2 UTSW 5 65790456 missense probably benign 0.02
R4177:N4bp2 UTSW 5 65798170 splice site probably null
R4718:N4bp2 UTSW 5 65803463 missense probably damaging 1.00
R4859:N4bp2 UTSW 5 65825298 missense probably damaging 1.00
R4863:N4bp2 UTSW 5 65808130 missense probably benign 0.22
R4915:N4bp2 UTSW 5 65803504 missense probably damaging 1.00
R4949:N4bp2 UTSW 5 65821799 splice site probably null
R4978:N4bp2 UTSW 5 65790240 missense probably damaging 1.00
R5029:N4bp2 UTSW 5 65814780 missense probably damaging 1.00
R5079:N4bp2 UTSW 5 65811977 missense probably damaging 1.00
R5097:N4bp2 UTSW 5 65817218 missense probably damaging 1.00
R5158:N4bp2 UTSW 5 65808462 missense probably damaging 0.99
R5228:N4bp2 UTSW 5 65807518 missense probably benign
R5322:N4bp2 UTSW 5 65790457 missense possibly damaging 0.76
R5554:N4bp2 UTSW 5 65808114 missense probably benign 0.44
R5731:N4bp2 UTSW 5 65809157 missense probably damaging 1.00
R5840:N4bp2 UTSW 5 65808094 missense probably damaging 0.99
R6393:N4bp2 UTSW 5 65791001 missense possibly damaging 0.81
R6767:N4bp2 UTSW 5 65817187 missense probably damaging 1.00
R7103:N4bp2 UTSW 5 65806846 missense probably benign 0.01
R7112:N4bp2 UTSW 5 65790707 missense possibly damaging 0.74
R7171:N4bp2 UTSW 5 65808022 missense probably benign 0.00
R7177:N4bp2 UTSW 5 65807548 missense probably damaging 1.00
R7240:N4bp2 UTSW 5 65794545 missense probably damaging 0.96
R7353:N4bp2 UTSW 5 65806371 missense probably benign 0.01
R7450:N4bp2 UTSW 5 65825300 nonsense probably null
R7560:N4bp2 UTSW 5 65791115 missense probably damaging 0.99
R7698:N4bp2 UTSW 5 65808157 missense probably benign 0.00
R7743:N4bp2 UTSW 5 65808459 missense probably damaging 1.00
R7871:N4bp2 UTSW 5 65807103 missense probably benign 0.00
R7981:N4bp2 UTSW 5 65812142 missense probably benign 0.41
R8065:N4bp2 UTSW 5 65807296 missense probably damaging 0.99
R8067:N4bp2 UTSW 5 65807296 missense probably damaging 0.99
R8164:N4bp2 UTSW 5 65809223 missense probably damaging 1.00
R8166:N4bp2 UTSW 5 65820312 missense probably benign 0.39
R8331:N4bp2 UTSW 5 65807600 missense probably damaging 1.00
Z1177:N4bp2 UTSW 5 65807637 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTACTGGCTCTTTGGAAGTAAAG -3'
(R):5'- TCCAGGAAAACTTGCAACATG -3'

Sequencing Primer
(F):5'- TGTGAAATTTGCAAACATGGAAG -3'
(R):5'- CCAGGAAAACTTGCAACATGTTCATG -3'
Posted On2014-06-23