Mutagenetix > Incidental Mutations

Incidental Mutation 'R1846:Polr1a'

207723

Institutional Source

Beutler Lab

Gene Symbol

Polr1a

Ensembl Gene

ENSMUSG00000049553

Gene Name

polymerase (RNA) I polypeptide A

Synonyms

RPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4

MMRRC Submission

039871-MU

Accession Numbers

Genbank: NM_009088; MGI: 1096397

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1846 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

71909053-71984935 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 71976188 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1580 (I1580T)

Ref Sequence

ENSEMBL: ENSMUSP00000060858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055296]

AlphaFold

O35134

Predicted Effect

probably damaging
Transcript: ENSMUST00000055296
AA Change: I1580T

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: I1580T

Domain	Start	End	E-Value	Type
RPOLA_N	302	649	8.97e-137	SMART
Pfam:RNA_pol_Rpb1_4	846	958	1.3e-26	PFAM
Pfam:RNA_pol_Rpb1_5	965	1669	7e-103	PFAM
low complexity region	1698	1708	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000205517
AA Change: I605T

Meta Mutation Damage Score

0.6173

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.6%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]

Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011H14Rik	G	T	14: 49,235,963	L102I	probably damaging	Het
2900092C05Rik	G	A	7: 12,512,882	R63Q	probably benign	Het
Adamts20	A	T	15: 94,345,990	C619S	probably damaging	Het
Alx1	T	C	10: 103,025,304	D121G	possibly damaging	Het
Anks3	A	C	16: 4,953,884	M215R	probably benign	Het
Anxa4	T	A	6: 86,741,911		probably null	Het
Arhgef25	A	G	10: 127,185,864	V222A	probably damaging	Het
Bglap2	A	G	3: 88,378,625		probably benign	Het
Cars2	A	G	8: 11,514,674	V22A	probably benign	Het
Cenpe	T	A	3: 135,239,845	I1040N	probably damaging	Het
Cep170	C	T	1: 176,755,769	D1015N	probably damaging	Het
Chia1	T	A	3: 106,130,865	I359N	probably damaging	Het
Crot	A	T	5: 8,988,248	V93E	probably benign	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dnmbp	T	C	19: 43,902,747	I194V	probably damaging	Het
Dock4	T	A	12: 40,733,268	C734S	probably benign	Het
Eif4e3	T	C	6: 99,640,701	S70G	probably benign	Het
Entpd3	G	A	9: 120,558,375	D213N	probably benign	Het
Ern2	T	G	7: 122,176,536	Y445S	probably benign	Het
Fasn	A	G	11: 120,813,307	S1429P	probably benign	Het
Fat4	A	G	3: 38,982,383	I3395V	probably benign	Het
Fbln2	C	A	6: 91,256,417	Q628K	possibly damaging	Het
Fbxo28	T	C	1: 182,326,280	N164D	probably benign	Het
Fez1	T	C	9: 36,867,767	S247P	probably damaging	Het
Gars	A	G	6: 55,063,168	D360G	probably benign	Het
Gcfc2	A	T	6: 81,956,892	Q710L	probably damaging	Het
Ggt5	A	G	10: 75,610,542		probably null	Het
Glp1r	A	G	17: 30,929,935		probably null	Het
Hspa14	T	C	2: 3,491,660	D356G	possibly damaging	Het
Htt	T	A	5: 34,848,944	I1399N	probably damaging	Het
Kmt2e	G	A	5: 23,499,486		probably benign	Het
Krt36	C	A	11: 100,105,548	G17C	probably damaging	Het
Lama2	T	C	10: 27,212,096	E895G	probably damaging	Het
Lamb2	G	A	9: 108,487,387	R1142H	probably benign	Het
Lhcgr	C	T	17: 88,765,147		probably null	Het
Lpin2	A	G	17: 71,225,069	T140A	probably benign	Het
Metap1	A	G	3: 138,480,682		probably benign	Het
Mpeg1	T	C	19: 12,463,122	V648A	probably benign	Het
Mroh2a	A	G	1: 88,258,664	S64G	probably benign	Het
Muc4	T	A	16: 32,752,369	I749N	probably benign	Het
N4bp2	T	C	5: 65,808,519	F1304L	probably damaging	Het
Nup85	A	G	11: 115,568,413	E114G	probably benign	Het
Olfr1258	A	G	2: 89,930,666	T286A	possibly damaging	Het
Olfr1415	A	T	1: 92,491,100	Y218*	probably null	Het
Olfr448	A	G	6: 42,897,320	S290G	probably damaging	Het
Pafah2	GCCCC	GCCCCC	4: 134,425,541		probably null	Het
Parp2	T	A	14: 50,815,386	C145*	probably null	Het
Plpp6	T	C	19: 28,964,280	S94P	probably benign	Het
Polrmt	A	T	10: 79,738,209	V860E	probably damaging	Het
Ppp1r17	A	G	6: 56,022,427	E15G	possibly damaging	Het
Prl7b1	A	T	13: 27,602,848	W133R	probably damaging	Het
Ptk7	A	G	17: 46,576,490		probably null	Het
Rad23b	C	T	4: 55,383,637	Q290*	probably null	Het
Rorb	C	T	19: 18,955,081	E369K	probably damaging	Het
Rusc1	T	C	3: 89,092,145	D110G	probably damaging	Het
Smg7	A	G	1: 152,848,850	S527P	probably damaging	Het
Ssbp2	C	T	13: 91,664,149	P105L	probably damaging	Het
Stt3a	C	T	9: 36,763,385	R34H	probably damaging	Het
Sufu	T	A	19: 46,450,947	I202N	possibly damaging	Het
Thsd7b	G	A	1: 129,613,256	R289Q	probably damaging	Het
Tph1	A	T	7: 46,660,439	S130T	probably damaging	Het
Ttn	A	G	2: 76,945,686	S1671P	probably damaging	Het
Usp4	A	G	9: 108,372,736	I441V	probably benign	Het
Vmn1r8	A	G	6: 57,036,428	N155D	probably benign	Het
Vmn2r115	A	C	17: 23,359,383	K610T	probably damaging	Het
Vmn2r62	G	A	7: 42,789,122	P97S	probably damaging	Het
Zbtb40	T	C	4: 137,007,839	D297G	probably benign	Het
Zfp174	C	A	16: 3,854,735	Q383K	probably benign	Het
Zfp318	T	A	17: 46,413,666	D2198E	probably benign	Het
Zfp628	C	T	7: 4,920,867	P696L	possibly damaging	Het
Zgrf1	T	A	3: 127,615,463	N1695K	probably damaging	Het

Other mutations in Polr1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Polr1a	APN	6	71948486	missense	probably benign	0.32
IGL01834:Polr1a	APN	6	71948462	missense	probably benign
IGL01902:Polr1a	APN	6	71963748	missense	probably damaging	1.00
IGL02101:Polr1a	APN	6	71950802	missense	probably benign	0.00
IGL02325:Polr1a	APN	6	71920657	missense	probably benign	0.38
IGL02398:Polr1a	APN	6	71936556	splice site	probably benign
IGL02528:Polr1a	APN	6	71964717	missense	probably benign
IGL02555:Polr1a	APN	6	71920457	missense	probably damaging	0.98
IGL02613:Polr1a	APN	6	71967320	missense	probably damaging	1.00
IGL02693:Polr1a	APN	6	71963846	splice site	probably benign
IGL02892:Polr1a	APN	6	71931696	missense	possibly damaging	0.70
IGL03059:Polr1a	APN	6	71936512	missense	probably benign
IGL03174:Polr1a	APN	6	71977347	missense	possibly damaging	0.82
D4043:Polr1a	UTSW	6	71941417	missense	possibly damaging	0.92
R0092:Polr1a	UTSW	6	71967455	splice site	probably benign
R0217:Polr1a	UTSW	6	71963703	missense	probably benign	0.19
R0267:Polr1a	UTSW	6	71974139	missense	probably damaging	0.99
R0329:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0330:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0352:Polr1a	UTSW	6	71920763	splice site	probably benign
R0411:Polr1a	UTSW	6	71978421	missense	possibly damaging	0.95
R0446:Polr1a	UTSW	6	71950664	critical splice donor site	probably null
R0846:Polr1a	UTSW	6	71924643	missense	probably damaging	1.00
R1035:Polr1a	UTSW	6	71967916	missense	probably benign
R1294:Polr1a	UTSW	6	71912902	missense	probably damaging	0.99
R1460:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R1657:Polr1a	UTSW	6	71941535	missense	probably damaging	1.00
R1862:Polr1a	UTSW	6	71909203	missense	probably damaging	0.96
R1865:Polr1a	UTSW	6	71966524	missense	probably damaging	1.00
R1903:Polr1a	UTSW	6	71967914	missense	probably benign	0.02
R1937:Polr1a	UTSW	6	71936552	critical splice donor site	probably null
R2063:Polr1a	UTSW	6	71936285	splice site	probably null
R2071:Polr1a	UTSW	6	71976074	missense	possibly damaging	0.64
R2084:Polr1a	UTSW	6	71950809	missense	possibly damaging	0.69
R2377:Polr1a	UTSW	6	71972826	critical splice donor site	probably null
R2410:Polr1a	UTSW	6	71974882	missense	probably benign
R3001:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3001:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3002:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3924:Polr1a	UTSW	6	71929450	missense	probably benign	0.00
R4105:Polr1a	UTSW	6	71976191	missense	probably damaging	0.98
R4125:Polr1a	UTSW	6	71965706	missense	probably benign	0.00
R4271:Polr1a	UTSW	6	71953022	missense	probably benign	0.02
R4440:Polr1a	UTSW	6	71950848	missense	probably damaging	0.98
R4667:Polr1a	UTSW	6	71917821	missense	probably benign	0.30
R4769:Polr1a	UTSW	6	71950868	missense	probably benign	0.01
R4801:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4802:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4828:Polr1a	UTSW	6	71966401	missense	possibly damaging	0.93
R4911:Polr1a	UTSW	6	71909229	missense	possibly damaging	0.67
R5071:Polr1a	UTSW	6	71931709	missense	possibly damaging	0.71
R5165:Polr1a	UTSW	6	71967925	missense	probably damaging	1.00
R5223:Polr1a	UTSW	6	71967907	missense	possibly damaging	0.73
R5239:Polr1a	UTSW	6	71913037	missense	probably damaging	1.00
R5546:Polr1a	UTSW	6	71929366	missense	possibly damaging	0.64
R5599:Polr1a	UTSW	6	71967362	missense	possibly damaging	0.95
R5696:Polr1a	UTSW	6	71929426	missense	probably benign	0.05
R5850:Polr1a	UTSW	6	71926683	missense	probably benign	0.00
R6274:Polr1a	UTSW	6	71954890	splice site	probably null
R6526:Polr1a	UTSW	6	71929443	missense	possibly damaging	0.89
R6578:Polr1a	UTSW	6	71976041	missense	possibly damaging	0.93
R6660:Polr1a	UTSW	6	71967374	missense	probably damaging	0.98
R6892:Polr1a	UTSW	6	71964712	missense	possibly damaging	0.72
R7274:Polr1a	UTSW	6	71920516	nonsense	probably null
R7291:Polr1a	UTSW	6	71941456	missense	probably benign	0.02
R7311:Polr1a	UTSW	6	71950879	missense	possibly damaging	0.53
R7431:Polr1a	UTSW	6	71926659	missense	probably benign	0.14
R7479:Polr1a	UTSW	6	71936297	missense	probably damaging	1.00
R7607:Polr1a	UTSW	6	71913021	missense	probably benign
R7739:Polr1a	UTSW	6	71954835	missense	possibly damaging	0.94
R7746:Polr1a	UTSW	6	71941512	missense	probably damaging	1.00
R7764:Polr1a	UTSW	6	71953070	missense	probably damaging	1.00
R7835:Polr1a	UTSW	6	71915142	missense	probably benign	0.02
R8029:Polr1a	UTSW	6	71912956	nonsense	probably null
R8057:Polr1a	UTSW	6	71931660	missense	possibly damaging	0.95
R8144:Polr1a	UTSW	6	71950616	missense	probably benign
R8170:Polr1a	UTSW	6	71920749	missense	probably benign
R8320:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R8328:Polr1a	UTSW	6	71920734	missense	probably benign
R8331:Polr1a	UTSW	6	71976179	missense	probably damaging	1.00
R8362:Polr1a	UTSW	6	71964667	missense	probably benign	0.00
R8511:Polr1a	UTSW	6	71920520	missense	probably benign	0.01
R8709:Polr1a	UTSW	6	71974848	missense	probably benign
R8745:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R8784:Polr1a	UTSW	6	71950628	missense	probably benign
R9055:Polr1a	UTSW	6	71915069	missense	possibly damaging	0.46
R9088:Polr1a	UTSW	6	71931783	missense	probably benign	0.26
R9211:Polr1a	UTSW	6	71966537	missense	probably damaging	1.00
R9228:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R9240:Polr1a	UTSW	6	71963677	nonsense	probably null
R9267:Polr1a	UTSW	6	71965558	missense	probably benign
R9302:Polr1a	UTSW	6	71924699	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTAGGTGACTGTGAAGCTCC -3'
(R):5'- TCCTTGGGTCACAGATGAGG -3'

Sequencing Primer
(F):5'- CTGTGAAGCTCCCACTGATGAAG -3'
(R):5'- AATTTGGGATCCACAGTGTTGCAC -3'

Posted On

2014-06-23