Incidental Mutation 'R1846:Anxa4'
ID207725
Institutional Source Beutler Lab
Gene Symbol Anxa4
Ensembl Gene ENSMUSG00000029994
Gene Nameannexin A4
Synonymsannexin IV, Xanx-4, AIV, Anx4
MMRRC Submission 039871-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R1846 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location86736840-86793584 bp(-) (GRCm38)
Type of Mutationunclassified (4 bp from exon)
DNA Base Change (assembly) T to A at 86741911 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001187] [ENSMUST00000113675] [ENSMUST00000123732] [ENSMUST00000127152] [ENSMUST00000155456] [ENSMUST00000204398] [ENSMUST00000204441] [ENSMUST00000204441]
Predicted Effect probably damaging
Transcript: ENSMUST00000001187
AA Change: R275S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001187
Gene: ENSMUSG00000029994
AA Change: R275S

DomainStartEndE-ValueType
ANX 31 83 1.66e-20 SMART
ANX 103 155 6.69e-25 SMART
ANX 187 239 9.84e-23 SMART
ANX 262 314 2.37e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113675
AA Change: R275S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109305
Gene: ENSMUSG00000029994
AA Change: R275S

DomainStartEndE-ValueType
ANX 31 83 1.66e-20 SMART
ANX 103 155 6.69e-25 SMART
ANX 187 239 9.84e-23 SMART
ANX 262 314 2.37e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123732
AA Change: R253S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115346
Gene: ENSMUSG00000029994
AA Change: R253S

DomainStartEndE-ValueType
ANX 31 79 1.6e-13 SMART
ANX 81 133 6.69e-25 SMART
ANX 165 217 9.84e-23 SMART
Pfam:Annexin 227 254 1.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127152
SMART Domains Protein: ENSMUSP00000138194
Gene: ENSMUSG00000029994

DomainStartEndE-ValueType
ANX 31 83 1.66e-20 SMART
ANX 103 155 6.69e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135921
Predicted Effect probably damaging
Transcript: ENSMUST00000155456
AA Change: R171S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117378
Gene: ENSMUSG00000029994
AA Change: R171S

DomainStartEndE-ValueType
ANX 22 69 1.06e-2 SMART
ANX 83 135 9.84e-23 SMART
ANX 158 210 2.37e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204398
SMART Domains Protein: ENSMUSP00000144961
Gene: ENSMUSG00000029994

DomainStartEndE-ValueType
ANX 31 83 7.1e-23 SMART
ANX 103 155 2.8e-27 SMART
ANX 187 239 4.3e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000204441
SMART Domains Protein: ENSMUSP00000145421
Gene: ENSMUSG00000029994

DomainStartEndE-ValueType
ANX 31 83 7.1e-23 SMART
ANX 103 155 2.8e-27 SMART
ANX 187 239 4.3e-25 SMART
Pfam:Annexin 249 274 5.4e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204441
SMART Domains Protein: ENSMUSP00000145421
Gene: ENSMUSG00000029994

DomainStartEndE-ValueType
ANX 31 83 7.1e-23 SMART
ANX 103 155 2.8e-27 SMART
ANX 187 239 4.3e-25 SMART
Pfam:Annexin 249 274 5.4e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204551
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Annexin IV (ANX4) belongs to the annexin family of calcium-dependent phospholipid binding proteins. Although their functions are still not clearly defined, several members of the annexin family have been implicated in membrane-related events along exocytotic and endocytotic pathways. ANX4 has 45 to 59% identity with other members of its family and shares a similar size and exon-intron organization. Isolated from human placenta, ANX4 encodes a protein that has possible interactions with ATP, and has in vitro anticoagulant activity and also inhibits phospholipase A2 activity. ANX4 is almost exclusively expressed in epithelial cells. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene-trapped allele often display abnormal maternal nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik G T 14: 49,235,963 L102I probably damaging Het
2900092C05Rik G A 7: 12,512,882 R63Q probably benign Het
Adamts20 A T 15: 94,345,990 C619S probably damaging Het
Alx1 T C 10: 103,025,304 D121G possibly damaging Het
Anks3 A C 16: 4,953,884 M215R probably benign Het
Arhgef25 A G 10: 127,185,864 V222A probably damaging Het
Bglap2 A G 3: 88,378,625 probably benign Het
Cars2 A G 8: 11,514,674 V22A probably benign Het
Cenpe T A 3: 135,239,845 I1040N probably damaging Het
Cep170 C T 1: 176,755,769 D1015N probably damaging Het
Chia1 T A 3: 106,130,865 I359N probably damaging Het
Crot A T 5: 8,988,248 V93E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnmbp T C 19: 43,902,747 I194V probably damaging Het
Dock4 T A 12: 40,733,268 C734S probably benign Het
Eif4e3 T C 6: 99,640,701 S70G probably benign Het
Entpd3 G A 9: 120,558,375 D213N probably benign Het
Ern2 T G 7: 122,176,536 Y445S probably benign Het
Fasn A G 11: 120,813,307 S1429P probably benign Het
Fat4 A G 3: 38,982,383 I3395V probably benign Het
Fbln2 C A 6: 91,256,417 Q628K possibly damaging Het
Fbxo28 T C 1: 182,326,280 N164D probably benign Het
Fez1 T C 9: 36,867,767 S247P probably damaging Het
Gars A G 6: 55,063,168 D360G probably benign Het
Gcfc2 A T 6: 81,956,892 Q710L probably damaging Het
Ggt5 A G 10: 75,610,542 probably null Het
Glp1r A G 17: 30,929,935 probably null Het
Hspa14 T C 2: 3,491,660 D356G possibly damaging Het
Htt T A 5: 34,848,944 I1399N probably damaging Het
Kmt2e G A 5: 23,499,486 probably benign Het
Krt36 C A 11: 100,105,548 G17C probably damaging Het
Lama2 T C 10: 27,212,096 E895G probably damaging Het
Lamb2 G A 9: 108,487,387 R1142H probably benign Het
Lhcgr C T 17: 88,765,147 probably null Het
Lpin2 A G 17: 71,225,069 T140A probably benign Het
Metap1 A G 3: 138,480,682 probably benign Het
Mpeg1 T C 19: 12,463,122 V648A probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Muc4 T A 16: 32,752,369 I749N probably benign Het
N4bp2 T C 5: 65,808,519 F1304L probably damaging Het
Nup85 A G 11: 115,568,413 E114G probably benign Het
Olfr1258 A G 2: 89,930,666 T286A possibly damaging Het
Olfr1415 A T 1: 92,491,100 Y218* probably null Het
Olfr448 A G 6: 42,897,320 S290G probably damaging Het
Pafah2 GCCCC GCCCCC 4: 134,425,541 probably null Het
Parp2 T A 14: 50,815,386 C145* probably null Het
Plpp6 T C 19: 28,964,280 S94P probably benign Het
Polr1a T C 6: 71,976,188 I1580T probably damaging Het
Polrmt A T 10: 79,738,209 V860E probably damaging Het
Ppp1r17 A G 6: 56,022,427 E15G possibly damaging Het
Prl7b1 A T 13: 27,602,848 W133R probably damaging Het
Ptk7 A G 17: 46,576,490 probably null Het
Rad23b C T 4: 55,383,637 Q290* probably null Het
Rorb C T 19: 18,955,081 E369K probably damaging Het
Rusc1 T C 3: 89,092,145 D110G probably damaging Het
Smg7 A G 1: 152,848,850 S527P probably damaging Het
Ssbp2 C T 13: 91,664,149 P105L probably damaging Het
Stt3a C T 9: 36,763,385 R34H probably damaging Het
Sufu T A 19: 46,450,947 I202N possibly damaging Het
Thsd7b G A 1: 129,613,256 R289Q probably damaging Het
Tph1 A T 7: 46,660,439 S130T probably damaging Het
Ttn A G 2: 76,945,686 S1671P probably damaging Het
Usp4 A G 9: 108,372,736 I441V probably benign Het
Vmn1r8 A G 6: 57,036,428 N155D probably benign Het
Vmn2r115 A C 17: 23,359,383 K610T probably damaging Het
Vmn2r62 G A 7: 42,789,122 P97S probably damaging Het
Zbtb40 T C 4: 137,007,839 D297G probably benign Het
Zfp174 C A 16: 3,854,735 Q383K probably benign Het
Zfp318 T A 17: 46,413,666 D2198E probably benign Het
Zfp628 C T 7: 4,920,867 P696L possibly damaging Het
Zgrf1 T A 3: 127,615,463 N1695K probably damaging Het
Other mutations in Anxa4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Anxa4 APN 6 86752205 missense probably damaging 1.00
IGL02601:Anxa4 APN 6 86760701 missense probably benign 0.00
R0423:Anxa4 UTSW 6 86760737 missense probably damaging 1.00
R0948:Anxa4 UTSW 6 86741931 missense probably damaging 1.00
R2341:Anxa4 UTSW 6 86743153 missense probably benign 0.38
R4058:Anxa4 UTSW 6 86757818 critical splice donor site probably null
R5000:Anxa4 UTSW 6 86765784 utr 5 prime probably benign
R5390:Anxa4 UTSW 6 86753883 missense probably damaging 1.00
R6503:Anxa4 UTSW 6 86744667 missense probably damaging 1.00
R6897:Anxa4 UTSW 6 86743178 critical splice acceptor site probably null
R7625:Anxa4 UTSW 6 86737819 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGCCCACATAAAATTGTTAC -3'
(R):5'- GGTAAGGCATGAGGATGTTCC -3'

Sequencing Primer
(F):5'- TTCTTATATACCATGAGAAAGGGGGC -3'
(R):5'- GGATGTTCCTCGGGCCTC -3'
Posted On2014-06-23