Incidental Mutation 'R1846:Ern2'
ID 207732
Institutional Source Beutler Lab
Gene Symbol Ern2
Ensembl Gene ENSMUSG00000030866
Gene Name endoplasmic reticulum to nucleus signalling 2
Synonyms Ire1b
MMRRC Submission 039871-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R1846 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 121769116-121785430 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 121775759 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Serine at position 445 (Y445S)
Ref Sequence ENSEMBL: ENSMUSP00000033153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033153] [ENSMUST00000206198]
AlphaFold Q9Z2E3
Predicted Effect probably benign
Transcript: ENSMUST00000033153
AA Change: Y445S

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000033153
Gene: ENSMUSG00000030866
AA Change: Y445S

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
PQQ 33 64 5.5e-8 SMART
PQQ 115 147 4.7e-4 SMART
PQQ 148 180 6.1e-2 SMART
PQQ 192 223 6.2e-3 SMART
low complexity region 449 461 N/A INTRINSIC
S_TKc 508 768 2.5e-11 SMART
PUG 831 888 9e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206198
AA Change: Y445S

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 99% (75/76)
MGI Phenotype PHENOTYPE: Mice homozygous for disruption of this gene are generally normal but display an increased susceptibility to intestinal inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik G A 7: 12,246,809 (GRCm39) R63Q probably benign Het
Adamts20 A T 15: 94,243,871 (GRCm39) C619S probably damaging Het
Alx1 T C 10: 102,861,165 (GRCm39) D121G possibly damaging Het
Anks3 A C 16: 4,771,748 (GRCm39) M215R probably benign Het
Anxa4 T A 6: 86,718,893 (GRCm39) probably null Het
Arhgef25 A G 10: 127,021,733 (GRCm39) V222A probably damaging Het
Bglap2 A G 3: 88,285,932 (GRCm39) probably benign Het
Cars2 A G 8: 11,564,674 (GRCm39) V22A probably benign Het
Ccdc198 G T 14: 49,473,420 (GRCm39) L102I probably damaging Het
Cenpe T A 3: 134,945,606 (GRCm39) I1040N probably damaging Het
Cep170 C T 1: 176,583,335 (GRCm39) D1015N probably damaging Het
Chia1 T A 3: 106,038,181 (GRCm39) I359N probably damaging Het
Crot A T 5: 9,038,248 (GRCm39) V93E probably benign Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dnmbp T C 19: 43,891,186 (GRCm39) I194V probably damaging Het
Dock4 T A 12: 40,783,267 (GRCm39) C734S probably benign Het
Eif4e3 T C 6: 99,617,662 (GRCm39) S70G probably benign Het
Entpd3 G A 9: 120,387,441 (GRCm39) D213N probably benign Het
Fasn A G 11: 120,704,133 (GRCm39) S1429P probably benign Het
Fat4 A G 3: 39,036,532 (GRCm39) I3395V probably benign Het
Fbln2 C A 6: 91,233,399 (GRCm39) Q628K possibly damaging Het
Fbxo28 T C 1: 182,153,845 (GRCm39) N164D probably benign Het
Fez1 T C 9: 36,779,063 (GRCm39) S247P probably damaging Het
Gars1 A G 6: 55,040,153 (GRCm39) D360G probably benign Het
Gcfc2 A T 6: 81,933,873 (GRCm39) Q710L probably damaging Het
Ggt5 A G 10: 75,446,376 (GRCm39) probably null Het
Glp1r A G 17: 31,148,909 (GRCm39) probably null Het
Hspa14 T C 2: 3,492,697 (GRCm39) D356G possibly damaging Het
Htt T A 5: 35,006,288 (GRCm39) I1399N probably damaging Het
Kmt2e G A 5: 23,704,484 (GRCm39) probably benign Het
Krt36 C A 11: 99,996,374 (GRCm39) G17C probably damaging Het
Lama2 T C 10: 27,088,092 (GRCm39) E895G probably damaging Het
Lamb2 G A 9: 108,364,586 (GRCm39) R1142H probably benign Het
Lhcgr C T 17: 89,072,575 (GRCm39) probably null Het
Lpin2 A G 17: 71,532,064 (GRCm39) T140A probably benign Het
Metap1 A G 3: 138,186,443 (GRCm39) probably benign Het
Mpeg1 T C 19: 12,440,486 (GRCm39) V648A probably benign Het
Mroh2a A G 1: 88,186,386 (GRCm39) S64G probably benign Het
Muc4 T A 16: 32,752,369 (GRCm38) I749N probably benign Het
N4bp2 T C 5: 65,965,862 (GRCm39) F1304L probably damaging Het
Nup85 A G 11: 115,459,239 (GRCm39) E114G probably benign Het
Or2a5 A G 6: 42,874,254 (GRCm39) S290G probably damaging Het
Or4c10 A G 2: 89,761,010 (GRCm39) T286A possibly damaging Het
Or6b2b A T 1: 92,418,822 (GRCm39) Y218* probably null Het
Pafah2 GCCCC GCCCCC 4: 134,152,852 (GRCm39) probably null Het
Parp2 T A 14: 51,052,843 (GRCm39) C145* probably null Het
Plpp6 T C 19: 28,941,680 (GRCm39) S94P probably benign Het
Polr1a T C 6: 71,953,172 (GRCm39) I1580T probably damaging Het
Polrmt A T 10: 79,574,043 (GRCm39) V860E probably damaging Het
Ppp1r17 A G 6: 55,999,412 (GRCm39) E15G possibly damaging Het
Prl7b1 A T 13: 27,786,831 (GRCm39) W133R probably damaging Het
Ptk7 A G 17: 46,887,416 (GRCm39) probably null Het
Rad23b C T 4: 55,383,637 (GRCm39) Q290* probably null Het
Rorb C T 19: 18,932,445 (GRCm39) E369K probably damaging Het
Rusc1 T C 3: 88,999,452 (GRCm39) D110G probably damaging Het
Smg7 A G 1: 152,724,601 (GRCm39) S527P probably damaging Het
Ssbp2 C T 13: 91,812,268 (GRCm39) P105L probably damaging Het
Stt3a C T 9: 36,674,681 (GRCm39) R34H probably damaging Het
Sufu T A 19: 46,439,386 (GRCm39) I202N possibly damaging Het
Thsd7b G A 1: 129,540,993 (GRCm39) R289Q probably damaging Het
Tph1 A T 7: 46,309,863 (GRCm39) S130T probably damaging Het
Ttn A G 2: 76,776,030 (GRCm39) S1671P probably damaging Het
Usp4 A G 9: 108,249,935 (GRCm39) I441V probably benign Het
Vmn1r8 A G 6: 57,013,413 (GRCm39) N155D probably benign Het
Vmn2r115 A C 17: 23,578,357 (GRCm39) K610T probably damaging Het
Vmn2r62 G A 7: 42,438,546 (GRCm39) P97S probably damaging Het
Zbtb40 T C 4: 136,735,150 (GRCm39) D297G probably benign Het
Zfp174 C A 16: 3,672,599 (GRCm39) Q383K probably benign Het
Zfp318 T A 17: 46,724,592 (GRCm39) D2198E probably benign Het
Zfp628 C T 7: 4,923,866 (GRCm39) P696L possibly damaging Het
Zgrf1 T A 3: 127,409,112 (GRCm39) N1695K probably damaging Het
Other mutations in Ern2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ern2 APN 7 121,769,315 (GRCm39) missense probably damaging 0.99
IGL01324:Ern2 APN 7 121,782,413 (GRCm39) missense possibly damaging 0.88
IGL02185:Ern2 APN 7 121,772,598 (GRCm39) splice site probably benign
IGL02738:Ern2 APN 7 121,782,122 (GRCm39) missense probably damaging 0.99
IGL02750:Ern2 APN 7 121,780,629 (GRCm39) splice site probably benign
IGL03247:Ern2 APN 7 121,770,894 (GRCm39) missense probably benign 0.02
ernie UTSW 7 121,770,884 (GRCm39) critical splice donor site probably null
Ernie2 UTSW 7 121,780,085 (GRCm39) splice site probably benign
ernie3 UTSW 7 121,773,042 (GRCm39) critical splice acceptor site probably null
R0165:Ern2 UTSW 7 121,779,002 (GRCm39) missense probably benign 0.02
R0785:Ern2 UTSW 7 121,770,884 (GRCm39) critical splice donor site probably null
R0801:Ern2 UTSW 7 121,780,085 (GRCm39) splice site probably benign
R1345:Ern2 UTSW 7 121,776,993 (GRCm39) missense probably damaging 1.00
R1649:Ern2 UTSW 7 121,776,623 (GRCm39) missense probably damaging 1.00
R1747:Ern2 UTSW 7 121,773,043 (GRCm39) critical splice acceptor site probably null
R1747:Ern2 UTSW 7 121,773,042 (GRCm39) critical splice acceptor site probably null
R1899:Ern2 UTSW 7 121,783,065 (GRCm39) splice site probably benign
R1986:Ern2 UTSW 7 121,770,752 (GRCm39) missense probably benign 0.06
R2055:Ern2 UTSW 7 121,783,168 (GRCm39) missense possibly damaging 0.84
R2329:Ern2 UTSW 7 121,772,710 (GRCm39) missense possibly damaging 0.82
R2351:Ern2 UTSW 7 121,770,731 (GRCm39) missense probably damaging 0.97
R2894:Ern2 UTSW 7 121,780,810 (GRCm39) missense possibly damaging 0.94
R3176:Ern2 UTSW 7 121,780,187 (GRCm39) missense possibly damaging 0.89
R3276:Ern2 UTSW 7 121,780,187 (GRCm39) missense possibly damaging 0.89
R3945:Ern2 UTSW 7 121,775,753 (GRCm39) missense probably benign 0.10
R4303:Ern2 UTSW 7 121,777,069 (GRCm39) critical splice acceptor site probably null
R4874:Ern2 UTSW 7 121,775,810 (GRCm39) missense probably benign 0.28
R4943:Ern2 UTSW 7 121,772,481 (GRCm39) missense possibly damaging 0.95
R5184:Ern2 UTSW 7 121,779,182 (GRCm39) missense probably benign 0.03
R5629:Ern2 UTSW 7 121,769,389 (GRCm39) missense probably damaging 1.00
R5770:Ern2 UTSW 7 121,779,130 (GRCm39) missense possibly damaging 0.92
R6255:Ern2 UTSW 7 121,772,495 (GRCm39) missense probably damaging 1.00
R6272:Ern2 UTSW 7 121,775,869 (GRCm39) missense probably benign 0.05
R6277:Ern2 UTSW 7 121,785,330 (GRCm39) missense probably benign
R6624:Ern2 UTSW 7 121,777,006 (GRCm39) missense probably benign 0.00
R6940:Ern2 UTSW 7 121,785,369 (GRCm39) missense probably benign 0.01
R7491:Ern2 UTSW 7 121,769,756 (GRCm39) missense probably damaging 1.00
R7544:Ern2 UTSW 7 121,772,422 (GRCm39) missense probably benign 0.06
R7555:Ern2 UTSW 7 121,769,464 (GRCm39) missense probably damaging 1.00
R7843:Ern2 UTSW 7 121,772,931 (GRCm39) missense probably damaging 1.00
R8281:Ern2 UTSW 7 121,769,483 (GRCm39) missense probably damaging 1.00
R8321:Ern2 UTSW 7 121,772,431 (GRCm39) missense probably damaging 1.00
R8377:Ern2 UTSW 7 121,780,515 (GRCm39) nonsense probably null
R8548:Ern2 UTSW 7 121,777,062 (GRCm39) missense probably damaging 1.00
R8853:Ern2 UTSW 7 121,772,967 (GRCm39) missense probably damaging 1.00
R8929:Ern2 UTSW 7 121,769,363 (GRCm39) missense probably benign 0.03
R8931:Ern2 UTSW 7 121,769,363 (GRCm39) missense probably benign 0.03
R9088:Ern2 UTSW 7 121,772,890 (GRCm39) missense probably damaging 1.00
R9511:Ern2 UTSW 7 121,776,823 (GRCm39) missense probably benign 0.03
R9789:Ern2 UTSW 7 121,769,485 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAGTGGGTGCCAGCCTTC -3'
(R):5'- GACCCAGTGATGAAGATTTGGG -3'

Sequencing Primer
(F):5'- AGCCTTCCTCCTGACGGAC -3'
(R):5'- CTCACAGGAGGAAGCTTTCAC -3'
Posted On 2014-06-23