Incidental Mutation 'R1846:Cars2'
ID207733
Institutional Source Beutler Lab
Gene Symbol Cars2
Ensembl Gene ENSMUSG00000056228
Gene Namecysteinyl-tRNA synthetase 2 (mitochondrial)(putative)
SynonymsD530030H10Rik, 2310051N18Rik, 2410044A07Rik
MMRRC Submission 039871-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R1846 (G1)
Quality Score223
Status Validated
Chromosome8
Chromosomal Location11513977-11550783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11514674 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 22 (V22A)
Ref Sequence ENSEMBL: ENSMUSP00000148016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033901] [ENSMUST00000049461] [ENSMUST00000177955] [ENSMUST00000178721] [ENSMUST00000178817] [ENSMUST00000210478] [ENSMUST00000211395]
Predicted Effect probably benign
Transcript: ENSMUST00000033901
SMART Domains Protein: ENSMUSP00000033901
Gene: ENSMUSG00000031505

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Pfam:Carb_kinase 94 356 6.2e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049461
AA Change: V467A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046453
Gene: ENSMUSG00000056228
AA Change: V467A

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:tRNA-synt_1e 50 351 4.1e-116 PFAM
Pfam:tRNA-synt_1g 63 207 1.5e-7 PFAM
Pfam:tRNA-synt_1g 280 370 4.2e-7 PFAM
Blast:DALR_2 391 461 3e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177955
SMART Domains Protein: ENSMUSP00000136363
Gene: ENSMUSG00000031505

DomainStartEndE-ValueType
Pfam:Carb_kinase 56 319 2.5e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178382
Predicted Effect probably benign
Transcript: ENSMUST00000178721
SMART Domains Protein: ENSMUSP00000136535
Gene: ENSMUSG00000031505

DomainStartEndE-ValueType
Pfam:Carb_kinase 56 242 1.4e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178817
SMART Domains Protein: ENSMUSP00000137488
Gene: ENSMUSG00000031505

DomainStartEndE-ValueType
Pfam:Carb_kinase 56 79 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210316
Predicted Effect probably benign
Transcript: ENSMUST00000210478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211172
Predicted Effect probably benign
Transcript: ENSMUST00000211395
AA Change: V22A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative member of the class I family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of cysteine to tRNA molecules. A splice-site mutation in this gene has been associated with a novel progressive myoclonic epilepsy disease with similar symptoms to MERRF syndrome. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for an ENU-induced allele develop induced hyperactivity followed by head bobbing and tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik G T 14: 49,235,963 L102I probably damaging Het
2900092C05Rik G A 7: 12,512,882 R63Q probably benign Het
Adamts20 A T 15: 94,345,990 C619S probably damaging Het
Alx1 T C 10: 103,025,304 D121G possibly damaging Het
Anks3 A C 16: 4,953,884 M215R probably benign Het
Anxa4 T A 6: 86,741,911 probably null Het
Arhgef25 A G 10: 127,185,864 V222A probably damaging Het
Bglap2 A G 3: 88,378,625 probably benign Het
Cenpe T A 3: 135,239,845 I1040N probably damaging Het
Cep170 C T 1: 176,755,769 D1015N probably damaging Het
Chia1 T A 3: 106,130,865 I359N probably damaging Het
Crot A T 5: 8,988,248 V93E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnmbp T C 19: 43,902,747 I194V probably damaging Het
Dock4 T A 12: 40,733,268 C734S probably benign Het
Eif4e3 T C 6: 99,640,701 S70G probably benign Het
Entpd3 G A 9: 120,558,375 D213N probably benign Het
Ern2 T G 7: 122,176,536 Y445S probably benign Het
Fasn A G 11: 120,813,307 S1429P probably benign Het
Fat4 A G 3: 38,982,383 I3395V probably benign Het
Fbln2 C A 6: 91,256,417 Q628K possibly damaging Het
Fbxo28 T C 1: 182,326,280 N164D probably benign Het
Fez1 T C 9: 36,867,767 S247P probably damaging Het
Gars A G 6: 55,063,168 D360G probably benign Het
Gcfc2 A T 6: 81,956,892 Q710L probably damaging Het
Ggt5 A G 10: 75,610,542 probably null Het
Glp1r A G 17: 30,929,935 probably null Het
Hspa14 T C 2: 3,491,660 D356G possibly damaging Het
Htt T A 5: 34,848,944 I1399N probably damaging Het
Kmt2e G A 5: 23,499,486 probably benign Het
Krt36 C A 11: 100,105,548 G17C probably damaging Het
Lama2 T C 10: 27,212,096 E895G probably damaging Het
Lamb2 G A 9: 108,487,387 R1142H probably benign Het
Lhcgr C T 17: 88,765,147 probably null Het
Lpin2 A G 17: 71,225,069 T140A probably benign Het
Metap1 A G 3: 138,480,682 probably benign Het
Mpeg1 T C 19: 12,463,122 V648A probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Muc4 T A 16: 32,752,369 I749N probably benign Het
N4bp2 T C 5: 65,808,519 F1304L probably damaging Het
Nup85 A G 11: 115,568,413 E114G probably benign Het
Olfr1258 A G 2: 89,930,666 T286A possibly damaging Het
Olfr1415 A T 1: 92,491,100 Y218* probably null Het
Olfr448 A G 6: 42,897,320 S290G probably damaging Het
Pafah2 GCCCC GCCCCC 4: 134,425,541 probably null Het
Parp2 T A 14: 50,815,386 C145* probably null Het
Plpp6 T C 19: 28,964,280 S94P probably benign Het
Polr1a T C 6: 71,976,188 I1580T probably damaging Het
Polrmt A T 10: 79,738,209 V860E probably damaging Het
Ppp1r17 A G 6: 56,022,427 E15G possibly damaging Het
Prl7b1 A T 13: 27,602,848 W133R probably damaging Het
Ptk7 A G 17: 46,576,490 probably null Het
Rad23b C T 4: 55,383,637 Q290* probably null Het
Rorb C T 19: 18,955,081 E369K probably damaging Het
Rusc1 T C 3: 89,092,145 D110G probably damaging Het
Smg7 A G 1: 152,848,850 S527P probably damaging Het
Ssbp2 C T 13: 91,664,149 P105L probably damaging Het
Stt3a C T 9: 36,763,385 R34H probably damaging Het
Sufu T A 19: 46,450,947 I202N possibly damaging Het
Thsd7b G A 1: 129,613,256 R289Q probably damaging Het
Tph1 A T 7: 46,660,439 S130T probably damaging Het
Ttn A G 2: 76,945,686 S1671P probably damaging Het
Usp4 A G 9: 108,372,736 I441V probably benign Het
Vmn1r8 A G 6: 57,036,428 N155D probably benign Het
Vmn2r115 A C 17: 23,359,383 K610T probably damaging Het
Vmn2r62 G A 7: 42,789,122 P97S probably damaging Het
Zbtb40 T C 4: 137,007,839 D297G probably benign Het
Zfp174 C A 16: 3,854,735 Q383K probably benign Het
Zfp318 T A 17: 46,413,666 D2198E probably benign Het
Zfp628 C T 7: 4,920,867 P696L possibly damaging Het
Zgrf1 T A 3: 127,615,463 N1695K probably damaging Het
Other mutations in Cars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
madcow UTSW 8 11526034 missense probably damaging 1.00
PIT4810001:Cars2 UTSW 8 11514699 missense probably benign
R0633:Cars2 UTSW 8 11550511 missense probably benign 0.00
R0788:Cars2 UTSW 8 11529672 missense possibly damaging 0.76
R1493:Cars2 UTSW 8 11517817 critical splice donor site probably null
R1559:Cars2 UTSW 8 11530430 splice site probably null
R1954:Cars2 UTSW 8 11550286 missense probably damaging 1.00
R1955:Cars2 UTSW 8 11550286 missense probably damaging 1.00
R1993:Cars2 UTSW 8 11514515 missense probably benign 0.03
R2062:Cars2 UTSW 8 11547747 missense probably damaging 1.00
R2153:Cars2 UTSW 8 11530299 missense possibly damaging 0.87
R5004:Cars2 UTSW 8 11518956 unclassified probably null
R5320:Cars2 UTSW 8 11517854 missense probably benign 0.09
R6004:Cars2 UTSW 8 11547743 missense probably damaging 1.00
R6089:Cars2 UTSW 8 11530301 missense probably damaging 0.98
R6265:Cars2 UTSW 8 11529599 frame shift probably null
R6267:Cars2 UTSW 8 11529599 frame shift probably null
R6268:Cars2 UTSW 8 11529599 frame shift probably null
R6841:Cars2 UTSW 8 11516198 missense probably benign 0.01
R7076:Cars2 UTSW 8 11529649 missense probably damaging 1.00
R7586:Cars2 UTSW 8 11530321 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATTGATGCCATGGGTGACGAG -3'
(R):5'- CTTAACGTGGGCCAGTCAAG -3'

Sequencing Primer
(F):5'- CATGGGTGACGAGGTCCTGTC -3'
(R):5'- GAGCTGATCTTGCTAGTAACCTAACC -3'
Posted On2014-06-23