Mutagenetix > Incidental Mutations

Incidental Mutation 'R1846:Krt36'

207745

Institutional Source

Beutler Lab

Gene Symbol

Krt36

Ensembl Gene

ENSMUSG00000020916

Gene Name

keratin 36

Synonyms

Krt1-22, keratin 5, HRa-1, Krt1-5

MMRRC Submission

039871-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R1846 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100102007-100105626 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 100105548 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Cysteine at position 17 (G17C)

Ref Sequence

ENSEMBL: ENSMUSP00000103039 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107416]

AlphaFold

B1AQ75

Predicted Effect

probably damaging
Transcript: ENSMUST00000107416
AA Change: G17C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000103039
Gene: ENSMUSG00000020916
AA Change: G17C

Domain	Start	End	E-Value	Type
low complexity region	22	36	N/A	INTRINSIC
Filament	92	403	4.05e-163	SMART
low complexity region	425	443	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127883

Meta Mutation Damage Score

0.2153

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.6%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. This type I hair keratin is an acidic protein which heterodimerizes with type II keratins to form hair and nails. The type I hair keratins are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hyperkeratosis affecting the scales of the tail skin and the filiform papillae of the tongue. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011H14Rik	G	T	14: 49,235,963	L102I	probably damaging	Het
2900092C05Rik	G	A	7: 12,512,882	R63Q	probably benign	Het
Adamts20	A	T	15: 94,345,990	C619S	probably damaging	Het
Alx1	T	C	10: 103,025,304	D121G	possibly damaging	Het
Anks3	A	C	16: 4,953,884	M215R	probably benign	Het
Anxa4	T	A	6: 86,741,911		probably null	Het
Arhgef25	A	G	10: 127,185,864	V222A	probably damaging	Het
Bglap2	A	G	3: 88,378,625		probably benign	Het
Cars2	A	G	8: 11,514,674	V22A	probably benign	Het
Cenpe	T	A	3: 135,239,845	I1040N	probably damaging	Het
Cep170	C	T	1: 176,755,769	D1015N	probably damaging	Het
Chia1	T	A	3: 106,130,865	I359N	probably damaging	Het
Crot	A	T	5: 8,988,248	V93E	probably benign	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dnmbp	T	C	19: 43,902,747	I194V	probably damaging	Het
Dock4	T	A	12: 40,733,268	C734S	probably benign	Het
Eif4e3	T	C	6: 99,640,701	S70G	probably benign	Het
Entpd3	G	A	9: 120,558,375	D213N	probably benign	Het
Ern2	T	G	7: 122,176,536	Y445S	probably benign	Het
Fasn	A	G	11: 120,813,307	S1429P	probably benign	Het
Fat4	A	G	3: 38,982,383	I3395V	probably benign	Het
Fbln2	C	A	6: 91,256,417	Q628K	possibly damaging	Het
Fbxo28	T	C	1: 182,326,280	N164D	probably benign	Het
Fez1	T	C	9: 36,867,767	S247P	probably damaging	Het
Gars	A	G	6: 55,063,168	D360G	probably benign	Het
Gcfc2	A	T	6: 81,956,892	Q710L	probably damaging	Het
Ggt5	A	G	10: 75,610,542		probably null	Het
Glp1r	A	G	17: 30,929,935		probably null	Het
Hspa14	T	C	2: 3,491,660	D356G	possibly damaging	Het
Htt	T	A	5: 34,848,944	I1399N	probably damaging	Het
Kmt2e	G	A	5: 23,499,486		probably benign	Het
Lama2	T	C	10: 27,212,096	E895G	probably damaging	Het
Lamb2	G	A	9: 108,487,387	R1142H	probably benign	Het
Lhcgr	C	T	17: 88,765,147		probably null	Het
Lpin2	A	G	17: 71,225,069	T140A	probably benign	Het
Metap1	A	G	3: 138,480,682		probably benign	Het
Mpeg1	T	C	19: 12,463,122	V648A	probably benign	Het
Mroh2a	A	G	1: 88,258,664	S64G	probably benign	Het
Muc4	T	A	16: 32,752,369	I749N	probably benign	Het
N4bp2	T	C	5: 65,808,519	F1304L	probably damaging	Het
Nup85	A	G	11: 115,568,413	E114G	probably benign	Het
Olfr1258	A	G	2: 89,930,666	T286A	possibly damaging	Het
Olfr1415	A	T	1: 92,491,100	Y218*	probably null	Het
Olfr448	A	G	6: 42,897,320	S290G	probably damaging	Het
Pafah2	GCCCC	GCCCCC	4: 134,425,541		probably null	Het
Parp2	T	A	14: 50,815,386	C145*	probably null	Het
Plpp6	T	C	19: 28,964,280	S94P	probably benign	Het
Polr1a	T	C	6: 71,976,188	I1580T	probably damaging	Het
Polrmt	A	T	10: 79,738,209	V860E	probably damaging	Het
Ppp1r17	A	G	6: 56,022,427	E15G	possibly damaging	Het
Prl7b1	A	T	13: 27,602,848	W133R	probably damaging	Het
Ptk7	A	G	17: 46,576,490		probably null	Het
Rad23b	C	T	4: 55,383,637	Q290*	probably null	Het
Rorb	C	T	19: 18,955,081	E369K	probably damaging	Het
Rusc1	T	C	3: 89,092,145	D110G	probably damaging	Het
Smg7	A	G	1: 152,848,850	S527P	probably damaging	Het
Ssbp2	C	T	13: 91,664,149	P105L	probably damaging	Het
Stt3a	C	T	9: 36,763,385	R34H	probably damaging	Het
Sufu	T	A	19: 46,450,947	I202N	possibly damaging	Het
Thsd7b	G	A	1: 129,613,256	R289Q	probably damaging	Het
Tph1	A	T	7: 46,660,439	S130T	probably damaging	Het
Ttn	A	G	2: 76,945,686	S1671P	probably damaging	Het
Usp4	A	G	9: 108,372,736	I441V	probably benign	Het
Vmn1r8	A	G	6: 57,036,428	N155D	probably benign	Het
Vmn2r115	A	C	17: 23,359,383	K610T	probably damaging	Het
Vmn2r62	G	A	7: 42,789,122	P97S	probably damaging	Het
Zbtb40	T	C	4: 137,007,839	D297G	probably benign	Het
Zfp174	C	A	16: 3,854,735	Q383K	probably benign	Het
Zfp318	T	A	17: 46,413,666	D2198E	probably benign	Het
Zfp628	C	T	7: 4,920,867	P696L	possibly damaging	Het
Zgrf1	T	A	3: 127,615,463	N1695K	probably damaging	Het

Other mutations in Krt36

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00978:Krt36	APN	11	100102948	missense	probably damaging	0.98
IGL01737:Krt36	APN	11	100104120	missense	possibly damaging	0.62
IGL02388:Krt36	APN	11	100105164	nonsense	probably null
IGL02985:Krt36	APN	11	100103179	missense	probably benign	0.32
R0393:Krt36	UTSW	11	100104114	missense	possibly damaging	0.91
R0617:Krt36	UTSW	11	100102275	missense	probably damaging	1.00
R0930:Krt36	UTSW	11	100103399	missense	probably damaging	1.00
R1166:Krt36	UTSW	11	100102828	missense	probably benign	0.00
R1201:Krt36	UTSW	11	100104057	missense	probably benign	0.22
R1587:Krt36	UTSW	11	100102302	missense	probably damaging	1.00
R1750:Krt36	UTSW	11	100104058	missense	probably benign	0.00
R1826:Krt36	UTSW	11	100103030	splice site	probably benign
R2208:Krt36	UTSW	11	100102939	missense	probably damaging	0.96
R4303:Krt36	UTSW	11	100103413	missense	possibly damaging	0.59
R5140:Krt36	UTSW	11	100103502	missense	probably damaging	1.00
R5719:Krt36	UTSW	11	100104161	missense	possibly damaging	0.95
R5944:Krt36	UTSW	11	100105313	missense	probably benign
R6188:Krt36	UTSW	11	100102420	missense	probably benign	0.00
R6271:Krt36	UTSW	11	100104472	nonsense	probably null
R6809:Krt36	UTSW	11	100105509	missense	probably benign	0.00
R6856:Krt36	UTSW	11	100103390	missense	probably damaging	1.00
R7153:Krt36	UTSW	11	100105146	nonsense	probably null
R7602:Krt36	UTSW	11	100102960	missense	probably benign	0.00
R7822:Krt36	UTSW	11	100104140	missense	possibly damaging	0.86
R7894:Krt36	UTSW	11	100105235	missense	probably damaging	1.00
R8234:Krt36	UTSW	11	100104201	missense	probably damaging	1.00
R8480:Krt36	UTSW	11	100102809	missense	possibly damaging	0.95
R8904:Krt36	UTSW	11	100105347	missense	probably benign	0.00
R8969:Krt36	UTSW	11	100102303	missense	probably damaging	0.98
R8987:Krt36	UTSW	11	100103546	missense	possibly damaging	0.74
R9297:Krt36	UTSW	11	100103445	missense	probably damaging	1.00
R9314:Krt36	UTSW	11	100103401	nonsense	probably null
R9387:Krt36	UTSW	11	100104080	missense	probably damaging	1.00
Z1088:Krt36	UTSW	11	100104189	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- AAGATCTGCATGGTCGCCTTC -3'
(R):5'- GCTTTCCCAAGAGCTAAAGACATAG -3'

Sequencing Primer
(F):5'- GCCTTCTCGTTGCCATTGAAGG -3'
(R):5'- GAGCTAAAGACATAGAACATGCC -3'

Posted On

2014-06-23