Incidental Mutation 'R1846:Nup85'
ID207746
Institutional Source Beutler Lab
Gene Symbol Nup85
Ensembl Gene ENSMUSG00000020739
Gene Namenucleoporin 85
Synonymsfrount, Pcnt1
MMRRC Submission 039871-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1846 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115564434-115583985 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115568413 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 114 (E114G)
Ref Sequence ENSEMBL: ENSMUSP00000021085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021085] [ENSMUST00000144473]
Predicted Effect probably benign
Transcript: ENSMUST00000021085
AA Change: E114G

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000021085
Gene: ENSMUSG00000020739
AA Change: E114G

DomainStartEndE-ValueType
Pfam:Nucleopor_Nup85 53 606 1.2e-181 PFAM
low complexity region 635 649 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135893
Predicted Effect probably benign
Transcript: ENSMUST00000144473
SMART Domains Protein: ENSMUSP00000116069
Gene: ENSMUSG00000020739

DomainStartEndE-ValueType
Pfam:Nucleopor_Nup85 1 170 3e-56 PFAM
Pfam:Nucleopor_Nup85 168 274 1.1e-47 PFAM
Meta Mutation Damage Score 0.6144 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein component of the Nup107-160 subunit of the nuclear pore complex. Nuclear pore complexes are embedded in the nuclear envelope and promote bidirectional transport of macromolecules between the cytoplasm and nucleus. The encoded protein can also bind to the C-terminus of chemokine (C-C motif) receptor 2 (CCR2) and promote chemotaxis of monocytes, thereby participating in the inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik G T 14: 49,235,963 L102I probably damaging Het
2900092C05Rik G A 7: 12,512,882 R63Q probably benign Het
Adamts20 A T 15: 94,345,990 C619S probably damaging Het
Alx1 T C 10: 103,025,304 D121G possibly damaging Het
Anks3 A C 16: 4,953,884 M215R probably benign Het
Anxa4 T A 6: 86,741,911 probably null Het
Arhgef25 A G 10: 127,185,864 V222A probably damaging Het
Bglap2 A G 3: 88,378,625 probably benign Het
Cars2 A G 8: 11,514,674 V22A probably benign Het
Cenpe T A 3: 135,239,845 I1040N probably damaging Het
Cep170 C T 1: 176,755,769 D1015N probably damaging Het
Chia1 T A 3: 106,130,865 I359N probably damaging Het
Crot A T 5: 8,988,248 V93E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnmbp T C 19: 43,902,747 I194V probably damaging Het
Dock4 T A 12: 40,733,268 C734S probably benign Het
Eif4e3 T C 6: 99,640,701 S70G probably benign Het
Entpd3 G A 9: 120,558,375 D213N probably benign Het
Ern2 T G 7: 122,176,536 Y445S probably benign Het
Fasn A G 11: 120,813,307 S1429P probably benign Het
Fat4 A G 3: 38,982,383 I3395V probably benign Het
Fbln2 C A 6: 91,256,417 Q628K possibly damaging Het
Fbxo28 T C 1: 182,326,280 N164D probably benign Het
Fez1 T C 9: 36,867,767 S247P probably damaging Het
Gars A G 6: 55,063,168 D360G probably benign Het
Gcfc2 A T 6: 81,956,892 Q710L probably damaging Het
Ggt5 A G 10: 75,610,542 probably null Het
Glp1r A G 17: 30,929,935 probably null Het
Hspa14 T C 2: 3,491,660 D356G possibly damaging Het
Htt T A 5: 34,848,944 I1399N probably damaging Het
Kmt2e G A 5: 23,499,486 probably benign Het
Krt36 C A 11: 100,105,548 G17C probably damaging Het
Lama2 T C 10: 27,212,096 E895G probably damaging Het
Lamb2 G A 9: 108,487,387 R1142H probably benign Het
Lhcgr C T 17: 88,765,147 probably null Het
Lpin2 A G 17: 71,225,069 T140A probably benign Het
Metap1 A G 3: 138,480,682 probably benign Het
Mpeg1 T C 19: 12,463,122 V648A probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Muc4 T A 16: 32,752,369 I749N probably benign Het
N4bp2 T C 5: 65,808,519 F1304L probably damaging Het
Olfr1258 A G 2: 89,930,666 T286A possibly damaging Het
Olfr1415 A T 1: 92,491,100 Y218* probably null Het
Olfr448 A G 6: 42,897,320 S290G probably damaging Het
Pafah2 GCCCC GCCCCC 4: 134,425,541 probably null Het
Parp2 T A 14: 50,815,386 C145* probably null Het
Plpp6 T C 19: 28,964,280 S94P probably benign Het
Polr1a T C 6: 71,976,188 I1580T probably damaging Het
Polrmt A T 10: 79,738,209 V860E probably damaging Het
Ppp1r17 A G 6: 56,022,427 E15G possibly damaging Het
Prl7b1 A T 13: 27,602,848 W133R probably damaging Het
Ptk7 A G 17: 46,576,490 probably null Het
Rad23b C T 4: 55,383,637 Q290* probably null Het
Rorb C T 19: 18,955,081 E369K probably damaging Het
Rusc1 T C 3: 89,092,145 D110G probably damaging Het
Smg7 A G 1: 152,848,850 S527P probably damaging Het
Ssbp2 C T 13: 91,664,149 P105L probably damaging Het
Stt3a C T 9: 36,763,385 R34H probably damaging Het
Sufu T A 19: 46,450,947 I202N possibly damaging Het
Thsd7b G A 1: 129,613,256 R289Q probably damaging Het
Tph1 A T 7: 46,660,439 S130T probably damaging Het
Ttn A G 2: 76,945,686 S1671P probably damaging Het
Usp4 A G 9: 108,372,736 I441V probably benign Het
Vmn1r8 A G 6: 57,036,428 N155D probably benign Het
Vmn2r115 A C 17: 23,359,383 K610T probably damaging Het
Vmn2r62 G A 7: 42,789,122 P97S probably damaging Het
Zbtb40 T C 4: 137,007,839 D297G probably benign Het
Zfp174 C A 16: 3,854,735 Q383K probably benign Het
Zfp318 T A 17: 46,413,666 D2198E probably benign Het
Zfp628 C T 7: 4,920,867 P696L possibly damaging Het
Zgrf1 T A 3: 127,615,463 N1695K probably damaging Het
Other mutations in Nup85
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00550:Nup85 APN 11 115581756 missense probably damaging 1.00
IGL01538:Nup85 APN 11 115569714 missense possibly damaging 0.81
IGL01775:Nup85 APN 11 115580767 missense probably damaging 1.00
IGL02170:Nup85 APN 11 115577931 missense probably damaging 0.97
IGL02456:Nup85 APN 11 115581865 unclassified probably benign
IGL02888:Nup85 APN 11 115578800 missense possibly damaging 0.89
IGL03210:Nup85 APN 11 115566636 missense probably benign 0.11
PIT4403001:Nup85 UTSW 11 115581820 missense probably damaging 0.98
R0195:Nup85 UTSW 11 115564531 start codon destroyed probably null 1.00
R0394:Nup85 UTSW 11 115564531 start codon destroyed probably null 1.00
R0639:Nup85 UTSW 11 115564531 start codon destroyed probably null 1.00
R0883:Nup85 UTSW 11 115568370 nonsense probably null
R1567:Nup85 UTSW 11 115568398 missense possibly damaging 0.83
R1774:Nup85 UTSW 11 115582945 missense probably benign 0.01
R1851:Nup85 UTSW 11 115581817 missense probably damaging 1.00
R2084:Nup85 UTSW 11 115568691 missense possibly damaging 0.71
R4766:Nup85 UTSW 11 115577925 splice site probably null
R5748:Nup85 UTSW 11 115580512 missense probably damaging 1.00
R6362:Nup85 UTSW 11 115583734 missense probably damaging 0.98
R6906:Nup85 UTSW 11 115580943 missense probably damaging 1.00
R6951:Nup85 UTSW 11 115582955 missense possibly damaging 0.95
R7835:Nup85 UTSW 11 115570071 missense probably benign 0.35
R7918:Nup85 UTSW 11 115570071 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- CATGAGTTTATATGTACTGGAGGCC -3'
(R):5'- TCTCCTAAGCCCTCAGAAGC -3'

Sequencing Primer
(F):5'- TGGAGGCCAGAGCACTCAG -3'
(R):5'- AGAAGCCCCATACGGTTTTTG -3'
Posted On2014-06-23