Incidental Mutation 'R1846:Dock4'
ID207748
Institutional Source Beutler Lab
Gene Symbol Dock4
Ensembl Gene ENSMUSG00000035954
Gene Namededicator of cytokinesis 4
SynonymsEST N28122, 6330411N01Rik
MMRRC Submission 039871-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R1846 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location40445952-40846874 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40733268 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 734 (C734S)
Ref Sequence ENSEMBL: ENSMUSP00000047387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037488] [ENSMUST00000220912]
Predicted Effect probably benign
Transcript: ENSMUST00000037488
AA Change: C734S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000047387
Gene: ENSMUSG00000035954
AA Change: C734S

DomainStartEndE-ValueType
SH3 9 66 7.29e-10 SMART
Pfam:DOCK_N 69 392 8.2e-110 PFAM
Pfam:DOCK-C2 397 583 1.9e-55 PFAM
low complexity region 829 842 N/A INTRINSIC
Pfam:DHR-2 1092 1596 5e-108 PFAM
low complexity region 1651 1664 N/A INTRINSIC
low complexity region 1681 1696 N/A INTRINSIC
low complexity region 1700 1713 N/A INTRINSIC
low complexity region 1842 1872 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1940 1950 N/A INTRINSIC
low complexity region 1958 1973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220912
AA Change: C734S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222287
Meta Mutation Damage Score 0.0602 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the dedicator of cytokinesis (DOCK) family and encodes a protein with a DHR-1 (CZH-1) domain, a DHR-2 (CZH-2) domain and an SH3 domain. This membrane-associated, cytoplasmic protein functions as a guanine nucleotide exchange factor and is involved in regulation of adherens junctions between cells. Mutations in this gene have been associated with ovarian, prostate, glioma, and colorectal cancers. Alternatively spliced variants which encode different protein isoforms have been described, but only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. Heterozygotes display altered blood vessel lumen formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik G T 14: 49,235,963 L102I probably damaging Het
2900092C05Rik G A 7: 12,512,882 R63Q probably benign Het
Adamts20 A T 15: 94,345,990 C619S probably damaging Het
Alx1 T C 10: 103,025,304 D121G possibly damaging Het
Anks3 A C 16: 4,953,884 M215R probably benign Het
Anxa4 T A 6: 86,741,911 probably null Het
Arhgef25 A G 10: 127,185,864 V222A probably damaging Het
Bglap2 A G 3: 88,378,625 probably benign Het
Cars2 A G 8: 11,514,674 V22A probably benign Het
Cenpe T A 3: 135,239,845 I1040N probably damaging Het
Cep170 C T 1: 176,755,769 D1015N probably damaging Het
Chia1 T A 3: 106,130,865 I359N probably damaging Het
Crot A T 5: 8,988,248 V93E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnmbp T C 19: 43,902,747 I194V probably damaging Het
Eif4e3 T C 6: 99,640,701 S70G probably benign Het
Entpd3 G A 9: 120,558,375 D213N probably benign Het
Ern2 T G 7: 122,176,536 Y445S probably benign Het
Fasn A G 11: 120,813,307 S1429P probably benign Het
Fat4 A G 3: 38,982,383 I3395V probably benign Het
Fbln2 C A 6: 91,256,417 Q628K possibly damaging Het
Fbxo28 T C 1: 182,326,280 N164D probably benign Het
Fez1 T C 9: 36,867,767 S247P probably damaging Het
Gars A G 6: 55,063,168 D360G probably benign Het
Gcfc2 A T 6: 81,956,892 Q710L probably damaging Het
Ggt5 A G 10: 75,610,542 probably null Het
Glp1r A G 17: 30,929,935 probably null Het
Hspa14 T C 2: 3,491,660 D356G possibly damaging Het
Htt T A 5: 34,848,944 I1399N probably damaging Het
Kmt2e G A 5: 23,499,486 probably benign Het
Krt36 C A 11: 100,105,548 G17C probably damaging Het
Lama2 T C 10: 27,212,096 E895G probably damaging Het
Lamb2 G A 9: 108,487,387 R1142H probably benign Het
Lhcgr C T 17: 88,765,147 probably null Het
Lpin2 A G 17: 71,225,069 T140A probably benign Het
Metap1 A G 3: 138,480,682 probably benign Het
Mpeg1 T C 19: 12,463,122 V648A probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Muc4 T A 16: 32,752,369 I749N probably benign Het
N4bp2 T C 5: 65,808,519 F1304L probably damaging Het
Nup85 A G 11: 115,568,413 E114G probably benign Het
Olfr1258 A G 2: 89,930,666 T286A possibly damaging Het
Olfr1415 A T 1: 92,491,100 Y218* probably null Het
Olfr448 A G 6: 42,897,320 S290G probably damaging Het
Pafah2 GCCCC GCCCCC 4: 134,425,541 probably null Het
Parp2 T A 14: 50,815,386 C145* probably null Het
Plpp6 T C 19: 28,964,280 S94P probably benign Het
Polr1a T C 6: 71,976,188 I1580T probably damaging Het
Polrmt A T 10: 79,738,209 V860E probably damaging Het
Ppp1r17 A G 6: 56,022,427 E15G possibly damaging Het
Prl7b1 A T 13: 27,602,848 W133R probably damaging Het
Ptk7 A G 17: 46,576,490 probably null Het
Rad23b C T 4: 55,383,637 Q290* probably null Het
Rorb C T 19: 18,955,081 E369K probably damaging Het
Rusc1 T C 3: 89,092,145 D110G probably damaging Het
Smg7 A G 1: 152,848,850 S527P probably damaging Het
Ssbp2 C T 13: 91,664,149 P105L probably damaging Het
Stt3a C T 9: 36,763,385 R34H probably damaging Het
Sufu T A 19: 46,450,947 I202N possibly damaging Het
Thsd7b G A 1: 129,613,256 R289Q probably damaging Het
Tph1 A T 7: 46,660,439 S130T probably damaging Het
Ttn A G 2: 76,945,686 S1671P probably damaging Het
Usp4 A G 9: 108,372,736 I441V probably benign Het
Vmn1r8 A G 6: 57,036,428 N155D probably benign Het
Vmn2r115 A C 17: 23,359,383 K610T probably damaging Het
Vmn2r62 G A 7: 42,789,122 P97S probably damaging Het
Zbtb40 T C 4: 137,007,839 D297G probably benign Het
Zfp174 C A 16: 3,854,735 Q383K probably benign Het
Zfp318 T A 17: 46,413,666 D2198E probably benign Het
Zfp628 C T 7: 4,920,867 P696L possibly damaging Het
Zgrf1 T A 3: 127,615,463 N1695K probably damaging Het
Other mutations in Dock4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dock4 APN 12 40832306 missense possibly damaging 0.48
IGL00726:Dock4 APN 12 40790068 splice site probably benign
IGL00790:Dock4 APN 12 40834391 missense probably damaging 1.00
IGL01061:Dock4 APN 12 40702969 missense probably benign 0.01
IGL01083:Dock4 APN 12 40788381 splice site probably benign
IGL01412:Dock4 APN 12 40730041 splice site probably benign
IGL01583:Dock4 APN 12 40810467 nonsense probably null
IGL01603:Dock4 APN 12 40693031 missense probably damaging 1.00
IGL01766:Dock4 APN 12 40446379 nonsense probably null
IGL02067:Dock4 APN 12 40834385 missense probably damaging 1.00
IGL02302:Dock4 APN 12 40725777 missense probably damaging 1.00
IGL02406:Dock4 APN 12 40777207 missense probably benign 0.01
IGL02547:Dock4 APN 12 40737479 missense probably benign
IGL02613:Dock4 APN 12 40810466 missense probably damaging 1.00
IGL02643:Dock4 APN 12 40668430 missense probably damaging 1.00
IGL02952:Dock4 APN 12 40710903 critical splice donor site probably null
IGL02994:Dock4 APN 12 40779160 missense probably damaging 0.99
IGL03096:Dock4 APN 12 40748001 missense probably benign 0.00
IGL03144:Dock4 APN 12 40692907 splice site probably benign
IGL03223:Dock4 APN 12 40817594 missense probably damaging 1.00
IGL03296:Dock4 APN 12 40733257 missense possibly damaging 0.84
IGL03349:Dock4 APN 12 40733310 missense probably benign 0.42
IGL03353:Dock4 APN 12 40817758 splice site probably null
R0046:Dock4 UTSW 12 40737360 splice site probably benign
R0046:Dock4 UTSW 12 40737360 splice site probably benign
R0110:Dock4 UTSW 12 40621312 splice site probably benign
R0238:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0238:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0239:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0239:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0472:Dock4 UTSW 12 40838438 intron probably benign
R0616:Dock4 UTSW 12 40704415 missense probably benign 0.31
R0647:Dock4 UTSW 12 40710884 missense probably damaging 1.00
R0706:Dock4 UTSW 12 40702923 missense probably damaging 0.98
R0791:Dock4 UTSW 12 40704481 missense probably damaging 1.00
R0940:Dock4 UTSW 12 40631627 splice site probably benign
R1087:Dock4 UTSW 12 40729938 missense probably benign 0.40
R1180:Dock4 UTSW 12 40640414 missense possibly damaging 0.52
R1194:Dock4 UTSW 12 40829616 missense probably damaging 1.00
R1463:Dock4 UTSW 12 40816325 frame shift probably null
R1468:Dock4 UTSW 12 40755810 missense probably benign 0.00
R1468:Dock4 UTSW 12 40755810 missense probably benign 0.00
R1523:Dock4 UTSW 12 40693025 missense possibly damaging 0.88
R1616:Dock4 UTSW 12 40669045 missense probably damaging 0.99
R1682:Dock4 UTSW 12 40725780 missense probably damaging 1.00
R1691:Dock4 UTSW 12 40725755 missense probably benign 0.26
R1693:Dock4 UTSW 12 40834722 missense probably benign 0.07
R1737:Dock4 UTSW 12 40807001 splice site probably null
R1802:Dock4 UTSW 12 40794598 missense possibly damaging 0.90
R1813:Dock4 UTSW 12 40636228 missense probably damaging 1.00
R1959:Dock4 UTSW 12 40710798 missense probably damaging 1.00
R1975:Dock4 UTSW 12 40779642 splice site probably benign
R1986:Dock4 UTSW 12 40730063 missense probably damaging 1.00
R2105:Dock4 UTSW 12 40692989 missense probably benign 0.00
R2134:Dock4 UTSW 12 40745668 missense probably benign
R2135:Dock4 UTSW 12 40745668 missense probably benign
R2154:Dock4 UTSW 12 40820662 missense probably damaging 1.00
R2154:Dock4 UTSW 12 40844548 small insertion probably benign
R2864:Dock4 UTSW 12 40730073 missense probably damaging 1.00
R2890:Dock4 UTSW 12 40623801 critical splice acceptor site probably null
R3086:Dock4 UTSW 12 40731863 missense probably benign 0.02
R3808:Dock4 UTSW 12 40672810 missense probably damaging 0.99
R3811:Dock4 UTSW 12 40779124 missense possibly damaging 0.87
R3836:Dock4 UTSW 12 40794624 critical splice donor site probably null
R3838:Dock4 UTSW 12 40794624 critical splice donor site probably null
R4091:Dock4 UTSW 12 40844267 missense probably damaging 0.99
R4735:Dock4 UTSW 12 40631526 missense probably benign 0.31
R4752:Dock4 UTSW 12 40446365 missense probably benign 0.04
R4828:Dock4 UTSW 12 40668437 missense probably damaging 1.00
R5039:Dock4 UTSW 12 40817746 missense probably damaging 1.00
R5092:Dock4 UTSW 12 40844441 missense probably benign
R5146:Dock4 UTSW 12 40649492 splice site probably null
R5213:Dock4 UTSW 12 40676742 missense probably damaging 1.00
R5214:Dock4 UTSW 12 40704466 missense probably benign 0.00
R5270:Dock4 UTSW 12 40733271 missense probably benign 0.02
R5426:Dock4 UTSW 12 40745745 missense probably damaging 1.00
R5474:Dock4 UTSW 12 40745731 missense probably benign
R5544:Dock4 UTSW 12 40834702 missense possibly damaging 0.87
R5615:Dock4 UTSW 12 40649480 missense probably benign 0.22
R5649:Dock4 UTSW 12 40844540 missense probably benign 0.03
R5702:Dock4 UTSW 12 40737491 missense probably benign 0.02
R5846:Dock4 UTSW 12 40817736 missense probably damaging 1.00
R5847:Dock4 UTSW 12 40621251 missense probably damaging 0.97
R5895:Dock4 UTSW 12 40755813 missense probably damaging 1.00
R5997:Dock4 UTSW 12 40755834 missense probably damaging 0.99
R6011:Dock4 UTSW 12 40817757 critical splice donor site probably null
R6022:Dock4 UTSW 12 40748110 missense probably benign 0.04
R6038:Dock4 UTSW 12 40733351 splice site probably null
R6038:Dock4 UTSW 12 40733351 splice site probably null
R6179:Dock4 UTSW 12 40731869 missense probably benign 0.00
R6479:Dock4 UTSW 12 40828955 missense probably damaging 1.00
R6516:Dock4 UTSW 12 40731899 missense possibly damaging 0.94
R6748:Dock4 UTSW 12 40704466 missense probably benign 0.44
R6752:Dock4 UTSW 12 40820617 missense probably damaging 1.00
R6814:Dock4 UTSW 12 40812326 critical splice donor site probably null
R6864:Dock4 UTSW 12 40745746 missense probably damaging 1.00
R6872:Dock4 UTSW 12 40812326 critical splice donor site probably null
R6891:Dock4 UTSW 12 40779136 missense probably damaging 1.00
R6937:Dock4 UTSW 12 40834635 missense probably benign 0.01
R6950:Dock4 UTSW 12 40733314 missense possibly damaging 0.80
R7081:Dock4 UTSW 12 40621286 missense probably damaging 1.00
R7129:Dock4 UTSW 12 40828879 missense probably damaging 1.00
R7140:Dock4 UTSW 12 40636159 missense probably benign 0.06
R7241:Dock4 UTSW 12 40794860 missense probably damaging 1.00
R7378:Dock4 UTSW 12 40788244 missense possibly damaging 0.94
R7714:Dock4 UTSW 12 40725649 nonsense probably null
R7720:Dock4 UTSW 12 40806975 missense probably damaging 0.99
X0028:Dock4 UTSW 12 40669047 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AAACATCTCAGGGTGGCTCG -3'
(R):5'- TGATGATGGCCAAGCGTCAG -3'

Sequencing Primer
(F):5'- CGGTTTCGGGATGAATTATTTAAAAG -3'
(R):5'- TGGCCAAGCGTCAGGAAAAAG -3'
Posted On2014-06-23