Incidental Mutation 'R1846:Ssbp2'
ID207752
Institutional Source Beutler Lab
Gene Symbol Ssbp2
Ensembl Gene ENSMUSG00000003992
Gene Namesingle-stranded DNA binding protein 2
SynonymsHspc116, 1500004K09Rik, 2310079I02Rik, 9330163K02Rik, A830008M03Rik
MMRRC Submission 039871-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1846 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location91460283-91703429 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 91664149 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 105 (P105L)
Ref Sequence ENSEMBL: ENSMUSP00000037115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004094] [ENSMUST00000042122] [ENSMUST00000231481]
Predicted Effect probably damaging
Transcript: ENSMUST00000004094
AA Change: P135L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004094
Gene: ENSMUSG00000003992
AA Change: P135L

DomainStartEndE-ValueType
LisH 18 50 2.18e-3 SMART
Pfam:SSDP 83 125 5.9e-19 PFAM
Pfam:SSDP 123 338 5.3e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000042122
AA Change: P105L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037115
Gene: ENSMUSG00000003992
AA Change: P105L

DomainStartEndE-ValueType
LisH 18 50 2.18e-3 SMART
Pfam:SSDP 94 313 2.7e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156547
Predicted Effect probably damaging
Transcript: ENSMUST00000231481
AA Change: P135L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.3679 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a protein complex that interacts with single-stranded DNA and is involved in the DNA damage response and maintenance of genome stability. The encoded protein may also play a role in telomere repair. A variant of this gene may be associated with survival in human glioblastoma patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice exhibit some perinatal lethality and premature death associated with increased incidence of lymphoma and carcinoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik G T 14: 49,235,963 L102I probably damaging Het
2900092C05Rik G A 7: 12,512,882 R63Q probably benign Het
Adamts20 A T 15: 94,345,990 C619S probably damaging Het
Alx1 T C 10: 103,025,304 D121G possibly damaging Het
Anks3 A C 16: 4,953,884 M215R probably benign Het
Anxa4 T A 6: 86,741,911 probably null Het
Arhgef25 A G 10: 127,185,864 V222A probably damaging Het
Bglap2 A G 3: 88,378,625 probably benign Het
Cars2 A G 8: 11,514,674 V22A probably benign Het
Cenpe T A 3: 135,239,845 I1040N probably damaging Het
Cep170 C T 1: 176,755,769 D1015N probably damaging Het
Chia1 T A 3: 106,130,865 I359N probably damaging Het
Crot A T 5: 8,988,248 V93E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnmbp T C 19: 43,902,747 I194V probably damaging Het
Dock4 T A 12: 40,733,268 C734S probably benign Het
Eif4e3 T C 6: 99,640,701 S70G probably benign Het
Entpd3 G A 9: 120,558,375 D213N probably benign Het
Ern2 T G 7: 122,176,536 Y445S probably benign Het
Fasn A G 11: 120,813,307 S1429P probably benign Het
Fat4 A G 3: 38,982,383 I3395V probably benign Het
Fbln2 C A 6: 91,256,417 Q628K possibly damaging Het
Fbxo28 T C 1: 182,326,280 N164D probably benign Het
Fez1 T C 9: 36,867,767 S247P probably damaging Het
Gars A G 6: 55,063,168 D360G probably benign Het
Gcfc2 A T 6: 81,956,892 Q710L probably damaging Het
Ggt5 A G 10: 75,610,542 probably null Het
Glp1r A G 17: 30,929,935 probably null Het
Hspa14 T C 2: 3,491,660 D356G possibly damaging Het
Htt T A 5: 34,848,944 I1399N probably damaging Het
Kmt2e G A 5: 23,499,486 probably benign Het
Krt36 C A 11: 100,105,548 G17C probably damaging Het
Lama2 T C 10: 27,212,096 E895G probably damaging Het
Lamb2 G A 9: 108,487,387 R1142H probably benign Het
Lhcgr C T 17: 88,765,147 probably null Het
Lpin2 A G 17: 71,225,069 T140A probably benign Het
Metap1 A G 3: 138,480,682 probably benign Het
Mpeg1 T C 19: 12,463,122 V648A probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Muc4 T A 16: 32,752,369 I749N probably benign Het
N4bp2 T C 5: 65,808,519 F1304L probably damaging Het
Nup85 A G 11: 115,568,413 E114G probably benign Het
Olfr1258 A G 2: 89,930,666 T286A possibly damaging Het
Olfr1415 A T 1: 92,491,100 Y218* probably null Het
Olfr448 A G 6: 42,897,320 S290G probably damaging Het
Pafah2 GCCCC GCCCCC 4: 134,425,541 probably null Het
Parp2 T A 14: 50,815,386 C145* probably null Het
Plpp6 T C 19: 28,964,280 S94P probably benign Het
Polr1a T C 6: 71,976,188 I1580T probably damaging Het
Polrmt A T 10: 79,738,209 V860E probably damaging Het
Ppp1r17 A G 6: 56,022,427 E15G possibly damaging Het
Prl7b1 A T 13: 27,602,848 W133R probably damaging Het
Ptk7 A G 17: 46,576,490 probably null Het
Rad23b C T 4: 55,383,637 Q290* probably null Het
Rorb C T 19: 18,955,081 E369K probably damaging Het
Rusc1 T C 3: 89,092,145 D110G probably damaging Het
Smg7 A G 1: 152,848,850 S527P probably damaging Het
Stt3a C T 9: 36,763,385 R34H probably damaging Het
Sufu T A 19: 46,450,947 I202N possibly damaging Het
Thsd7b G A 1: 129,613,256 R289Q probably damaging Het
Tph1 A T 7: 46,660,439 S130T probably damaging Het
Ttn A G 2: 76,945,686 S1671P probably damaging Het
Usp4 A G 9: 108,372,736 I441V probably benign Het
Vmn1r8 A G 6: 57,036,428 N155D probably benign Het
Vmn2r115 A C 17: 23,359,383 K610T probably damaging Het
Vmn2r62 G A 7: 42,789,122 P97S probably damaging Het
Zbtb40 T C 4: 137,007,839 D297G probably benign Het
Zfp174 C A 16: 3,854,735 Q383K probably benign Het
Zfp318 T A 17: 46,413,666 D2198E probably benign Het
Zfp628 C T 7: 4,920,867 P696L possibly damaging Het
Zgrf1 T A 3: 127,615,463 N1695K probably damaging Het
Other mutations in Ssbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02656:Ssbp2 APN 13 91669752 splice site probably benign
IGL02962:Ssbp2 APN 13 91642371 missense possibly damaging 0.84
IGL03201:Ssbp2 APN 13 91524601 missense probably damaging 1.00
R0190:Ssbp2 UTSW 13 91669710 missense probably damaging 1.00
R0277:Ssbp2 UTSW 13 91564596 splice site probably benign
R0329:Ssbp2 UTSW 13 91680579 splice site probably null
R0330:Ssbp2 UTSW 13 91680579 splice site probably null
R1551:Ssbp2 UTSW 13 91642392 critical splice donor site probably null
R1957:Ssbp2 UTSW 13 91664184 splice site probably benign
R3732:Ssbp2 UTSW 13 91524607 missense probably damaging 1.00
R3744:Ssbp2 UTSW 13 91680646 splice site probably benign
R4469:Ssbp2 UTSW 13 91694056 missense probably damaging 1.00
R4665:Ssbp2 UTSW 13 91539335 missense possibly damaging 0.48
R4724:Ssbp2 UTSW 13 91688814 missense possibly damaging 0.70
R5477:Ssbp2 UTSW 13 91664125 missense probably damaging 0.98
R6015:Ssbp2 UTSW 13 91669743 critical splice donor site probably null
R6332:Ssbp2 UTSW 13 91690908 missense probably benign 0.01
R6523:Ssbp2 UTSW 13 91693051 missense probably benign 0.09
R6548:Ssbp2 UTSW 13 91539351 missense possibly damaging 0.91
R6655:Ssbp2 UTSW 13 91664149 missense probably damaging 1.00
R7227:Ssbp2 UTSW 13 91675125 missense probably benign 0.00
R7295:Ssbp2 UTSW 13 91694003 intron probably null
R7401:Ssbp2 UTSW 13 91690883 missense probably benign 0.43
R7488:Ssbp2 UTSW 13 91675090 missense probably damaging 0.99
R7823:Ssbp2 UTSW 13 91642329 missense possibly damaging 0.95
X0026:Ssbp2 UTSW 13 91669688 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- GCAGGATGACAATTTTCTTGGAAG -3'
(R):5'- TTTCCCTGTTCCAACAAAACTTAGC -3'

Sequencing Primer
(F):5'- AAGCTTTTGTTCTGCTGGAAAC -3'
(R):5'- AGTCAGTCAGCACACAGTCTGG -3'
Posted On2014-06-23