Mutagenetix > Incidental Mutation

Incidental Mutation 'R1846:Ptk7'

207763

Institutional Source

Beutler Lab

Gene Symbol

Ptk7

Ensembl Gene

ENSMUSG00000023972

Gene Name

PTK7 protein tyrosine kinase 7

Synonyms

8430404F20Rik, mPTK7/CCK4, chz

MMRRC Submission

039871-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1846 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46564451-46629504 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 46576490 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000043703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044442]

AlphaFold

Q8BKG3

Predicted Effect

probably null
Transcript: ENSMUST00000044442

SMART Domains

Protein: ENSMUSP00000043703
Gene: ENSMUSG00000023972

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IGc2	36	100	1.48e-6	SMART
IGc2	133	199	8.12e-13	SMART
IGc2	229	300	5.01e-4	SMART
IGc2	326	390	1.96e-6	SMART
IG	410	491	6.02e-7	SMART
IGc2	507	569	1.19e-10	SMART
IGc2	596	663	2.6e-11	SMART
transmembrane domain	696	718	N/A	INTRINSIC
TyrKc	788	1053	4.34e-115	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181301

Meta Mutation Damage Score

0.9491

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.6%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine kinase family of proteins that transduce extracellular signals across the cell membrane. The encoded protein lacks detectable catalytic tyrosine kinase activity, is involved in the Wnt signaling pathway and plays a role in multiple cellular processes including polarity and adhesion. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele die perinatally with defects in neural tube closure and planar cell polarity in the ear. ENU-induced mutant mice show omphalocele, impaired neural tube, heart and lung development, rib defects, polydactyly, failed eyelid closure and altered cell polarity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011H14Rik	G	T	14: 49,235,963	L102I	probably damaging	Het
2900092C05Rik	G	A	7: 12,512,882	R63Q	probably benign	Het
Adamts20	A	T	15: 94,345,990	C619S	probably damaging	Het
Alx1	T	C	10: 103,025,304	D121G	possibly damaging	Het
Anks3	A	C	16: 4,953,884	M215R	probably benign	Het
Anxa4	T	A	6: 86,741,911		probably null	Het
Arhgef25	A	G	10: 127,185,864	V222A	probably damaging	Het
Bglap2	A	G	3: 88,378,625		probably benign	Het
Cars2	A	G	8: 11,514,674	V22A	probably benign	Het
Cenpe	T	A	3: 135,239,845	I1040N	probably damaging	Het
Cep170	C	T	1: 176,755,769	D1015N	probably damaging	Het
Chia1	T	A	3: 106,130,865	I359N	probably damaging	Het
Crot	A	T	5: 8,988,248	V93E	probably benign	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dnmbp	T	C	19: 43,902,747	I194V	probably damaging	Het
Dock4	T	A	12: 40,733,268	C734S	probably benign	Het
Eif4e3	T	C	6: 99,640,701	S70G	probably benign	Het
Entpd3	G	A	9: 120,558,375	D213N	probably benign	Het
Ern2	T	G	7: 122,176,536	Y445S	probably benign	Het
Fasn	A	G	11: 120,813,307	S1429P	probably benign	Het
Fat4	A	G	3: 38,982,383	I3395V	probably benign	Het
Fbln2	C	A	6: 91,256,417	Q628K	possibly damaging	Het
Fbxo28	T	C	1: 182,326,280	N164D	probably benign	Het
Fez1	T	C	9: 36,867,767	S247P	probably damaging	Het
Gars	A	G	6: 55,063,168	D360G	probably benign	Het
Gcfc2	A	T	6: 81,956,892	Q710L	probably damaging	Het
Ggt5	A	G	10: 75,610,542		probably null	Het
Glp1r	A	G	17: 30,929,935		probably null	Het
Hspa14	T	C	2: 3,491,660	D356G	possibly damaging	Het
Htt	T	A	5: 34,848,944	I1399N	probably damaging	Het
Kmt2e	G	A	5: 23,499,486		probably benign	Het
Krt36	C	A	11: 100,105,548	G17C	probably damaging	Het
Lama2	T	C	10: 27,212,096	E895G	probably damaging	Het
Lamb2	G	A	9: 108,487,387	R1142H	probably benign	Het
Lhcgr	C	T	17: 88,765,147		probably null	Het
Lpin2	A	G	17: 71,225,069	T140A	probably benign	Het
Metap1	A	G	3: 138,480,682		probably benign	Het
Mpeg1	T	C	19: 12,463,122	V648A	probably benign	Het
Mroh2a	A	G	1: 88,258,664	S64G	probably benign	Het
Muc4	T	A	16: 32,752,369	I749N	probably benign	Het
N4bp2	T	C	5: 65,808,519	F1304L	probably damaging	Het
Nup85	A	G	11: 115,568,413	E114G	probably benign	Het
Olfr1258	A	G	2: 89,930,666	T286A	possibly damaging	Het
Olfr1415	A	T	1: 92,491,100	Y218*	probably null	Het
Olfr448	A	G	6: 42,897,320	S290G	probably damaging	Het
Pafah2	GCCCC	GCCCCC	4: 134,425,541		probably null	Het
Parp2	T	A	14: 50,815,386	C145*	probably null	Het
Plpp6	T	C	19: 28,964,280	S94P	probably benign	Het
Polr1a	T	C	6: 71,976,188	I1580T	probably damaging	Het
Polrmt	A	T	10: 79,738,209	V860E	probably damaging	Het
Ppp1r17	A	G	6: 56,022,427	E15G	possibly damaging	Het
Prl7b1	A	T	13: 27,602,848	W133R	probably damaging	Het
Rad23b	C	T	4: 55,383,637	Q290*	probably null	Het
Rorb	C	T	19: 18,955,081	E369K	probably damaging	Het
Rusc1	T	C	3: 89,092,145	D110G	probably damaging	Het
Smg7	A	G	1: 152,848,850	S527P	probably damaging	Het
Ssbp2	C	T	13: 91,664,149	P105L	probably damaging	Het
Stt3a	C	T	9: 36,763,385	R34H	probably damaging	Het
Sufu	T	A	19: 46,450,947	I202N	possibly damaging	Het
Thsd7b	G	A	1: 129,613,256	R289Q	probably damaging	Het
Tph1	A	T	7: 46,660,439	S130T	probably damaging	Het
Ttn	A	G	2: 76,945,686	S1671P	probably damaging	Het
Usp4	A	G	9: 108,372,736	I441V	probably benign	Het
Vmn1r8	A	G	6: 57,036,428	N155D	probably benign	Het
Vmn2r115	A	C	17: 23,359,383	K610T	probably damaging	Het
Vmn2r62	G	A	7: 42,789,122	P97S	probably damaging	Het
Zbtb40	T	C	4: 137,007,839	D297G	probably benign	Het
Zfp174	C	A	16: 3,854,735	Q383K	probably benign	Het
Zfp318	T	A	17: 46,413,666	D2198E	probably benign	Het
Zfp628	C	T	7: 4,920,867	P696L	possibly damaging	Het
Zgrf1	T	A	3: 127,615,463	N1695K	probably damaging	Het

Other mutations in Ptk7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Ptk7	APN	17	46574427	missense	probably damaging	1.00
IGL01064:Ptk7	APN	17	46573566	nonsense	probably null
IGL01444:Ptk7	APN	17	46565387	missense	probably damaging	1.00
IGL01477:Ptk7	APN	17	46576880	missense	possibly damaging	0.61
IGL01727:Ptk7	APN	17	46572548	missense	probably damaging	1.00
IGL01958:Ptk7	APN	17	46579427	missense	probably benign	0.37
IGL02496:Ptk7	APN	17	46590144	missense	probably benign	0.04
IGL02864:Ptk7	APN	17	46572733	missense	probably damaging	1.00
R0008:Ptk7	UTSW	17	46572762	splice site	probably benign
R0671:Ptk7	UTSW	17	46590312	missense	possibly damaging	0.94
R1464:Ptk7	UTSW	17	46572591	missense	probably damaging	1.00
R1464:Ptk7	UTSW	17	46572591	missense	probably damaging	1.00
R1549:Ptk7	UTSW	17	46572652	missense	probably damaging	1.00
R1635:Ptk7	UTSW	17	46573534	missense	possibly damaging	0.81
R1646:Ptk7	UTSW	17	46586297	missense	probably benign	0.44
R1973:Ptk7	UTSW	17	46586807	nonsense	probably null
R2060:Ptk7	UTSW	17	46566238	missense	possibly damaging	0.83
R2155:Ptk7	UTSW	17	46579617	missense	probably benign	0.09
R2472:Ptk7	UTSW	17	46576848	missense	probably benign	0.35
R2937:Ptk7	UTSW	17	46572550	missense	probably damaging	0.99
R3824:Ptk7	UTSW	17	46565378	missense	probably damaging	1.00
R3845:Ptk7	UTSW	17	46586418	missense	probably benign	0.00
R4222:Ptk7	UTSW	17	46574463	missense	probably benign
R4671:Ptk7	UTSW	17	46574466	missense	probably benign
R4922:Ptk7	UTSW	17	46576491	critical splice donor site	probably null
R5319:Ptk7	UTSW	17	46572677	missense	probably damaging	1.00
R5993:Ptk7	UTSW	17	46565370	missense	probably benign
R6254:Ptk7	UTSW	17	46572642	missense	probably damaging	1.00
R6352:Ptk7	UTSW	17	46576890	missense	probably benign	0.00
R6806:Ptk7	UTSW	17	46573528	missense	probably damaging	0.99
R7338:Ptk7	UTSW	17	46579599	missense	probably benign	0.00
R7394:Ptk7	UTSW	17	46591757	missense	probably damaging	1.00
R7709:Ptk7	UTSW	17	46571643	missense	possibly damaging	0.81
R7949:Ptk7	UTSW	17	46586461	missense	possibly damaging	0.64
R8773:Ptk7	UTSW	17	46566267	missense	possibly damaging	0.88
R9059:Ptk7	UTSW	17	46566191	missense	probably damaging	1.00
R9327:Ptk7	UTSW	17	46568051	missense	probably benign	0.17
R9495:Ptk7	UTSW	17	46576818	missense	possibly damaging	0.82
R9514:Ptk7	UTSW	17	46576818	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- CCTGATGTTACAGCTGTTGCCAG -3'
(R):5'- ACAGCTCCGTTGCTCACTAC -3'

Sequencing Primer
(F):5'- TGTTGCCAGCGATGCAG -3'
(R):5'- CGTTGCTCACTACTTCCCAATC -3'

Posted On

2014-06-23