Incidental Mutation 'R1846:Ptk7'
ID207763
Institutional Source Beutler Lab
Gene Symbol Ptk7
Ensembl Gene ENSMUSG00000023972
Gene NamePTK7 protein tyrosine kinase 7
Synonyms8430404F20Rik, mPTK7/CCK4, chz
MMRRC Submission 039871-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1846 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46564451-46629504 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 46576490 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044442]
Predicted Effect probably null
Transcript: ENSMUST00000044442
SMART Domains Protein: ENSMUSP00000043703
Gene: ENSMUSG00000023972

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGc2 36 100 1.48e-6 SMART
IGc2 133 199 8.12e-13 SMART
IGc2 229 300 5.01e-4 SMART
IGc2 326 390 1.96e-6 SMART
IG 410 491 6.02e-7 SMART
IGc2 507 569 1.19e-10 SMART
IGc2 596 663 2.6e-11 SMART
transmembrane domain 696 718 N/A INTRINSIC
TyrKc 788 1053 4.34e-115 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine kinase family of proteins that transduce extracellular signals across the cell membrane. The encoded protein lacks detectable catalytic tyrosine kinase activity, is involved in the Wnt signaling pathway and plays a role in multiple cellular processes including polarity and adhesion. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele die perinatally with defects in neural tube closure and planar cell polarity in the ear. ENU-induced mutant mice show omphalocele, impaired neural tube, heart and lung development, rib defects, polydactyly, failed eyelid closure and altered cell polarity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik G T 14: 49,235,963 L102I probably damaging Het
2900092C05Rik G A 7: 12,512,882 R63Q probably benign Het
Adamts20 A T 15: 94,345,990 C619S probably damaging Het
Alx1 T C 10: 103,025,304 D121G possibly damaging Het
Anks3 A C 16: 4,953,884 M215R probably benign Het
Anxa4 T A 6: 86,741,911 probably null Het
Arhgef25 A G 10: 127,185,864 V222A probably damaging Het
Bglap2 A G 3: 88,378,625 probably benign Het
Cars2 A G 8: 11,514,674 V22A probably benign Het
Cenpe T A 3: 135,239,845 I1040N probably damaging Het
Cep170 C T 1: 176,755,769 D1015N probably damaging Het
Chia1 T A 3: 106,130,865 I359N probably damaging Het
Crot A T 5: 8,988,248 V93E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnmbp T C 19: 43,902,747 I194V probably damaging Het
Dock4 T A 12: 40,733,268 C734S probably benign Het
Eif4e3 T C 6: 99,640,701 S70G probably benign Het
Entpd3 G A 9: 120,558,375 D213N probably benign Het
Ern2 T G 7: 122,176,536 Y445S probably benign Het
Fasn A G 11: 120,813,307 S1429P probably benign Het
Fat4 A G 3: 38,982,383 I3395V probably benign Het
Fbln2 C A 6: 91,256,417 Q628K possibly damaging Het
Fbxo28 T C 1: 182,326,280 N164D probably benign Het
Fez1 T C 9: 36,867,767 S247P probably damaging Het
Gars A G 6: 55,063,168 D360G probably benign Het
Gcfc2 A T 6: 81,956,892 Q710L probably damaging Het
Ggt5 A G 10: 75,610,542 probably null Het
Glp1r A G 17: 30,929,935 probably null Het
Hspa14 T C 2: 3,491,660 D356G possibly damaging Het
Htt T A 5: 34,848,944 I1399N probably damaging Het
Kmt2e G A 5: 23,499,486 probably benign Het
Krt36 C A 11: 100,105,548 G17C probably damaging Het
Lama2 T C 10: 27,212,096 E895G probably damaging Het
Lamb2 G A 9: 108,487,387 R1142H probably benign Het
Lhcgr C T 17: 88,765,147 probably null Het
Lpin2 A G 17: 71,225,069 T140A probably benign Het
Metap1 A G 3: 138,480,682 probably benign Het
Mpeg1 T C 19: 12,463,122 V648A probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Muc4 T A 16: 32,752,369 I749N probably benign Het
N4bp2 T C 5: 65,808,519 F1304L probably damaging Het
Nup85 A G 11: 115,568,413 E114G probably benign Het
Olfr1258 A G 2: 89,930,666 T286A possibly damaging Het
Olfr1415 A T 1: 92,491,100 Y218* probably null Het
Olfr448 A G 6: 42,897,320 S290G probably damaging Het
Pafah2 GCCCC GCCCCC 4: 134,425,541 probably null Het
Parp2 T A 14: 50,815,386 C145* probably null Het
Plpp6 T C 19: 28,964,280 S94P probably benign Het
Polr1a T C 6: 71,976,188 I1580T probably damaging Het
Polrmt A T 10: 79,738,209 V860E probably damaging Het
Ppp1r17 A G 6: 56,022,427 E15G possibly damaging Het
Prl7b1 A T 13: 27,602,848 W133R probably damaging Het
Rad23b C T 4: 55,383,637 Q290* probably null Het
Rorb C T 19: 18,955,081 E369K probably damaging Het
Rusc1 T C 3: 89,092,145 D110G probably damaging Het
Smg7 A G 1: 152,848,850 S527P probably damaging Het
Ssbp2 C T 13: 91,664,149 P105L probably damaging Het
Stt3a C T 9: 36,763,385 R34H probably damaging Het
Sufu T A 19: 46,450,947 I202N possibly damaging Het
Thsd7b G A 1: 129,613,256 R289Q probably damaging Het
Tph1 A T 7: 46,660,439 S130T probably damaging Het
Ttn A G 2: 76,945,686 S1671P probably damaging Het
Usp4 A G 9: 108,372,736 I441V probably benign Het
Vmn1r8 A G 6: 57,036,428 N155D probably benign Het
Vmn2r115 A C 17: 23,359,383 K610T probably damaging Het
Vmn2r62 G A 7: 42,789,122 P97S probably damaging Het
Zbtb40 T C 4: 137,007,839 D297G probably benign Het
Zfp174 C A 16: 3,854,735 Q383K probably benign Het
Zfp318 T A 17: 46,413,666 D2198E probably benign Het
Zfp628 C T 7: 4,920,867 P696L possibly damaging Het
Zgrf1 T A 3: 127,615,463 N1695K probably damaging Het
Other mutations in Ptk7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Ptk7 APN 17 46574427 missense probably damaging 1.00
IGL01064:Ptk7 APN 17 46573566 nonsense probably null
IGL01444:Ptk7 APN 17 46565387 missense probably damaging 1.00
IGL01477:Ptk7 APN 17 46576880 missense possibly damaging 0.61
IGL01727:Ptk7 APN 17 46572548 missense probably damaging 1.00
IGL01958:Ptk7 APN 17 46579427 missense probably benign 0.37
IGL02496:Ptk7 APN 17 46590144 missense probably benign 0.04
IGL02864:Ptk7 APN 17 46572733 missense probably damaging 1.00
R0008:Ptk7 UTSW 17 46572762 splice site probably benign
R0671:Ptk7 UTSW 17 46590312 missense possibly damaging 0.94
R1464:Ptk7 UTSW 17 46572591 missense probably damaging 1.00
R1464:Ptk7 UTSW 17 46572591 missense probably damaging 1.00
R1549:Ptk7 UTSW 17 46572652 missense probably damaging 1.00
R1635:Ptk7 UTSW 17 46573534 missense possibly damaging 0.81
R1646:Ptk7 UTSW 17 46586297 missense probably benign 0.44
R1973:Ptk7 UTSW 17 46586807 nonsense probably null
R2060:Ptk7 UTSW 17 46566238 missense possibly damaging 0.83
R2155:Ptk7 UTSW 17 46579617 missense probably benign 0.09
R2472:Ptk7 UTSW 17 46576848 missense probably benign 0.35
R2937:Ptk7 UTSW 17 46572550 missense probably damaging 0.99
R3824:Ptk7 UTSW 17 46565378 missense probably damaging 1.00
R3845:Ptk7 UTSW 17 46586418 missense probably benign 0.00
R4222:Ptk7 UTSW 17 46574463 missense probably benign
R4671:Ptk7 UTSW 17 46574466 missense probably benign
R4922:Ptk7 UTSW 17 46576491 critical splice donor site probably null
R5319:Ptk7 UTSW 17 46572677 missense probably damaging 1.00
R5993:Ptk7 UTSW 17 46565370 missense probably benign
R6254:Ptk7 UTSW 17 46572642 missense probably damaging 1.00
R6352:Ptk7 UTSW 17 46576890 missense probably benign 0.00
R6806:Ptk7 UTSW 17 46573528 missense probably damaging 0.99
R7338:Ptk7 UTSW 17 46579599 missense probably benign 0.00
R7394:Ptk7 UTSW 17 46591757 missense probably damaging 1.00
R7709:Ptk7 UTSW 17 46571643 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CCTGATGTTACAGCTGTTGCCAG -3'
(R):5'- ACAGCTCCGTTGCTCACTAC -3'

Sequencing Primer
(F):5'- TGTTGCCAGCGATGCAG -3'
(R):5'- CGTTGCTCACTACTTCCCAATC -3'
Posted On2014-06-23