Incidental Mutation 'R1847:Trip12'
ID207771
Institutional Source Beutler Lab
Gene Symbol Trip12
Ensembl Gene ENSMUSG00000026219
Gene Namethyroid hormone receptor interactor 12
Synonyms6720416K24Rik, 1110036I07Rik, Gtl6
MMRRC Submission 039872-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1847 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location84721189-84840516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84749269 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 3 (H3Q)
Ref Sequence ENSEMBL: ENSMUSP00000140789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000185909] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000189670] [ENSMUST00000189841]
Predicted Effect probably damaging
Transcript: ENSMUST00000027421
AA Change: H1193Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: H1193Q

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 765 831 7.6e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185909
SMART Domains Protein: ENSMUSP00000139986
Gene: ENSMUSG00000026219

DomainStartEndE-ValueType
low complexity region 195 214 N/A INTRINSIC
low complexity region 219 230 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 273 289 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186465
AA Change: H1193Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: H1193Q

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 761 831 2.2e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186648
AA Change: H1160Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: H1160Q

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
low complexity region 410 421 N/A INTRINSIC
SCOP:d1ee4a_ 440 654 5e-20 SMART
PDB:1WA5|B 441 635 1e-5 PDB
low complexity region 950 973 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1029 1040 N/A INTRINSIC
low complexity region 1300 1311 N/A INTRINSIC
low complexity region 1312 1329 N/A INTRINSIC
Blast:HECTc 1330 1384 7e-8 BLAST
Blast:HECTc 1540 1596 2e-24 BLAST
HECTc 1603 1992 6.2e-180 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189670
AA Change: H3Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140789
Gene: ENSMUSG00000026219
AA Change: H3Q

DomainStartEndE-ValueType
low complexity region 138 149 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
Blast:HECTc 168 222 5e-8 BLAST
Blast:HECTc 378 434 1e-24 BLAST
HECTc 441 830 6.2e-180 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189841
SMART Domains Protein: ENSMUSP00000140879
Gene: ENSMUSG00000026219

DomainStartEndE-ValueType
low complexity region 1 24 N/A INTRINSIC
low complexity region 51 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190125
Meta Mutation Damage Score 0.4708 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 C A 16: 14,445,449 R758S probably benign Het
Acnat1 A T 4: 49,447,716 H288Q possibly damaging Het
Adamts1 T C 16: 85,802,226 E162G possibly damaging Het
Akap11 A G 14: 78,513,661 S429P probably benign Het
Alg14 T C 3: 121,361,766 Y212H probably damaging Het
Cacna1g T C 11: 94,466,181 T97A probably damaging Het
Ccdc112 T A 18: 46,287,754 N310Y possibly damaging Het
Cenpl A T 1: 161,086,004 Y328F probably damaging Het
Cep162 G A 9: 87,204,080 H1064Y probably benign Het
Cnksr3 T A 10: 7,154,324 E126D probably benign Het
Ctsh T A 9: 90,061,565 M81K probably benign Het
D6Wsu163e A G 6: 126,955,149 T284A probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnaaf1 T A 8: 119,582,877 M196K probably benign Het
Dnah9 C A 11: 65,834,386 G4314C probably damaging Het
Dph1 A G 11: 75,179,731 Y361H probably damaging Het
Ect2 C T 3: 27,150,072 M29I probably benign Het
Eif3h T C 15: 51,797,670 Y167C probably damaging Het
Epc2 C T 2: 49,532,089 R332C probably damaging Het
Fras1 C A 5: 96,749,423 probably null Het
Gfm2 A G 13: 97,162,934 I386V probably benign Het
Gpd1l G A 9: 114,914,331 T167I probably damaging Het
Hsph1 T A 5: 149,623,485 K567* probably null Het
Igfn1 T G 1: 135,969,388 S1147R probably benign Het
Itgb4 T C 11: 115,983,764 V406A probably benign Het
Kcna2 A G 3: 107,105,113 I337V possibly damaging Het
Kcnab1 T C 3: 65,302,194 probably null Het
Kri1 G T 9: 21,280,492 probably benign Het
Lrguk T A 6: 34,133,387 I801K possibly damaging Het
Magi2 A T 5: 20,602,460 N871Y probably damaging Het
Map3k10 G T 7: 27,661,556 probably null Het
Mrps25 T C 6: 92,178,740 T71A probably damaging Het
Myo15 G A 11: 60,499,495 W945* probably null Het
Ncan A T 8: 70,102,454 I1021N probably damaging Het
Ncf4 C A 15: 78,250,382 S11R probably benign Het
Neb A C 2: 52,196,295 S5255R possibly damaging Het
Nop2 TGATGAAGATGAAGATGA TGATGAAGATGA 6: 125,137,079 probably benign Het
Olfr1155 T C 2: 87,942,721 probably null Het
Olfr1189 G A 2: 88,592,172 A123T probably damaging Het
Olfr992 A T 2: 85,400,441 F31I probably damaging Het
Pacs1 T C 19: 5,153,714 I328V probably damaging Het
Pafah2 GCCCC GCCCCC 4: 134,425,541 probably null Het
Pan2 A G 10: 128,304,378 H56R possibly damaging Het
Pigo G A 4: 43,024,710 R124* probably null Het
Ppfia2 A G 10: 106,927,710 D1188G probably benign Het
Ppp1r16b A G 2: 158,761,435 N327D probably damaging Het
Psd3 A G 8: 67,720,004 C223R possibly damaging Het
Rad50 A G 11: 53,702,107 V72A possibly damaging Het
Rcor3 T A 1: 192,100,833 D445V possibly damaging Het
Rundc1 T A 11: 101,433,681 H404Q probably benign Het
Ryr1 T C 7: 29,079,811 K2083E probably benign Het
Scd3 C A 19: 44,235,842 H171Q probably damaging Het
Scrn2 T C 11: 97,032,195 F155L probably benign Het
Serpina12 A T 12: 104,032,510 L323Q probably damaging Het
Sptlc3 T A 2: 139,625,923 M467K probably benign Het
Stard9 G T 2: 120,698,489 R1742S possibly damaging Het
Thbd A T 2: 148,407,684 L88* probably null Het
Tln2 G A 9: 67,362,687 Q477* probably null Het
Tnn T A 1: 160,116,182 E1020D possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmp1 G A 11: 86,643,587 Q165* probably null Het
Zfp758 T A 17: 22,375,223 M230K probably benign Het
Other mutations in Trip12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Trip12 APN 1 84730541 missense probably damaging 1.00
IGL00430:Trip12 APN 1 84763861 missense probably damaging 0.96
IGL00465:Trip12 APN 1 84763861 missense probably damaging 0.96
IGL00819:Trip12 APN 1 84754272 missense probably damaging 1.00
IGL00900:Trip12 APN 1 84724764 missense possibly damaging 0.56
IGL00990:Trip12 APN 1 84751884 missense probably damaging 0.99
IGL01087:Trip12 APN 1 84757859 missense probably damaging 0.99
IGL01400:Trip12 APN 1 84751978 missense probably damaging 0.99
IGL01521:Trip12 APN 1 84766198 splice site probably benign
IGL01619:Trip12 APN 1 84814910 missense probably damaging 0.99
IGL01796:Trip12 APN 1 84728278 missense probably benign 0.42
IGL01975:Trip12 APN 1 84814813 splice site probably benign
IGL02190:Trip12 APN 1 84766070 missense probably damaging 0.98
IGL02474:Trip12 APN 1 84794133 missense probably benign
IGL02517:Trip12 APN 1 84743814 unclassified probably benign
IGL02631:Trip12 APN 1 84766008 missense possibly damaging 0.91
IGL02991:Trip12 APN 1 84738815 missense probably damaging 1.00
IGL03161:Trip12 APN 1 84761132 unclassified probably benign
IGL03388:Trip12 APN 1 84743186 missense probably damaging 0.99
cardamom UTSW 1 84749276 missense probably damaging 0.99
Turmeric UTSW 1 84754343 missense probably benign 0.07
LCD18:Trip12 UTSW 1 84754482 unclassified probably benign
R0090:Trip12 UTSW 1 84732136 splice site probably benign
R0111:Trip12 UTSW 1 84759133 unclassified probably benign
R0471:Trip12 UTSW 1 84726207 missense probably damaging 1.00
R0486:Trip12 UTSW 1 84761084 nonsense probably null
R0557:Trip12 UTSW 1 84724747 missense probably damaging 1.00
R0570:Trip12 UTSW 1 84751548 missense probably damaging 1.00
R0614:Trip12 UTSW 1 84757761 missense probably damaging 1.00
R0627:Trip12 UTSW 1 84768597 missense probably damaging 1.00
R0630:Trip12 UTSW 1 84793915 missense possibly damaging 0.70
R0657:Trip12 UTSW 1 84759050 missense probably benign 0.19
R0741:Trip12 UTSW 1 84745181 missense probably benign 0.09
R0862:Trip12 UTSW 1 84744009 missense probably damaging 0.99
R0864:Trip12 UTSW 1 84744009 missense probably damaging 0.99
R1124:Trip12 UTSW 1 84737037 missense probably damaging 1.00
R1252:Trip12 UTSW 1 84776350 nonsense probably null
R1455:Trip12 UTSW 1 84759100 missense probably benign 0.01
R1487:Trip12 UTSW 1 84768631 missense probably damaging 1.00
R1702:Trip12 UTSW 1 84745063 missense probably damaging 1.00
R1781:Trip12 UTSW 1 84730621 missense probably benign 0.01
R1854:Trip12 UTSW 1 84728145 missense probably damaging 1.00
R1866:Trip12 UTSW 1 84745060 missense probably damaging 1.00
R1926:Trip12 UTSW 1 84749291 missense probably damaging 0.98
R1935:Trip12 UTSW 1 84794101 missense possibly damaging 0.46
R1950:Trip12 UTSW 1 84760801 missense probably damaging 1.00
R1994:Trip12 UTSW 1 84749172 missense probably damaging 1.00
R2014:Trip12 UTSW 1 84760866 nonsense probably null
R2391:Trip12 UTSW 1 84814790 frame shift probably null
R2423:Trip12 UTSW 1 84814790 frame shift probably null
R2433:Trip12 UTSW 1 84743823 missense possibly damaging 0.84
R2905:Trip12 UTSW 1 84754343 missense probably benign 0.07
R3040:Trip12 UTSW 1 84742245 missense probably benign 0.13
R3735:Trip12 UTSW 1 84814790 frame shift probably null
R3907:Trip12 UTSW 1 84732106 missense possibly damaging 0.53
R4394:Trip12 UTSW 1 84725741 missense probably damaging 1.00
R4540:Trip12 UTSW 1 84749276 missense probably damaging 0.99
R4859:Trip12 UTSW 1 84793810 missense probably damaging 0.99
R5240:Trip12 UTSW 1 84794133 missense probably benign
R5278:Trip12 UTSW 1 84762147 missense probably damaging 1.00
R5377:Trip12 UTSW 1 84757431 missense probably damaging 1.00
R5510:Trip12 UTSW 1 84768680 missense probably damaging 1.00
R5542:Trip12 UTSW 1 84749344 missense probably damaging 1.00
R5550:Trip12 UTSW 1 84761099 missense probably damaging 0.99
R5886:Trip12 UTSW 1 84730458 intron probably benign
R5893:Trip12 UTSW 1 84759163 unclassified probably benign
R5914:Trip12 UTSW 1 84763458 missense probably damaging 1.00
R5925:Trip12 UTSW 1 84749253 nonsense probably null
R5985:Trip12 UTSW 1 84725771 missense probably damaging 0.99
R6135:Trip12 UTSW 1 84760838 missense probably benign 0.00
R6158:Trip12 UTSW 1 84761012 missense possibly damaging 0.84
R6419:Trip12 UTSW 1 84793870 missense probably damaging 1.00
R6816:Trip12 UTSW 1 84793714 missense probably damaging 0.99
R7144:Trip12 UTSW 1 84793714 missense probably damaging 0.99
R7194:Trip12 UTSW 1 84794222 missense probably benign 0.07
R7355:Trip12 UTSW 1 84814883 missense probably damaging 1.00
R7361:Trip12 UTSW 1 84750442 missense probably damaging 0.98
R7588:Trip12 UTSW 1 84760883 missense probably damaging 0.99
R7705:Trip12 UTSW 1 84777449 missense probably damaging 1.00
R7818:Trip12 UTSW 1 84760806 missense probably damaging 1.00
X0023:Trip12 UTSW 1 84760787 missense probably benign 0.12
X0065:Trip12 UTSW 1 84749163 missense probably benign 0.21
Z1088:Trip12 UTSW 1 84766168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACACAAATACATCCACTTGCTAG -3'
(R):5'- ACATAGTGACCCTTCCAGATAATG -3'

Sequencing Primer
(F):5'- AGCTCTGACTCTTAGTACCCATGAG -3'
(R):5'- GATCTAAGCCCAGTAGTGCTCTAG -3'
Posted On2014-06-23