Mutagenetix > Incidental Mutation

Incidental Mutation 'R1847:Trip12'

207771

Institutional Source

Beutler Lab

Gene Symbol

Trip12

Ensembl Gene

ENSMUSG00000026219

Gene Name

thyroid hormone receptor interactor 12

Synonyms

6720416K24Rik, 1110036I07Rik, Gtl6

MMRRC Submission

039872-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1847 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84721189-84840516 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 84749269 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 3 (H3Q)

Ref Sequence

ENSEMBL: ENSMUSP00000140789 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000185909] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000189670] [ENSMUST00000189841]

AlphaFold

G5E870

Predicted Effect

probably damaging
Transcript: ENSMUST00000027421
AA Change: H1193Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: H1193Q

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	765	831	7.6e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185909

SMART Domains

Protein: ENSMUSP00000139986
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	195	214	N/A	INTRINSIC
low complexity region	219	230	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	273	289	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000186465
AA Change: H1193Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: H1193Q

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	761	831	2.2e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186648
AA Change: H1160Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: H1160Q

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	386	400	N/A	INTRINSIC
low complexity region	410	421	N/A	INTRINSIC
SCOP:d1ee4a_	440	654	5e-20	SMART
PDB:1WA5\|B	441	635	1e-5	PDB
low complexity region	950	973	N/A	INTRINSIC
low complexity region	1000	1014	N/A	INTRINSIC
low complexity region	1029	1040	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1312	1329	N/A	INTRINSIC
Blast:HECTc	1330	1384	7e-8	BLAST
Blast:HECTc	1540	1596	2e-24	BLAST
HECTc	1603	1992	6.2e-180	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000189670
AA Change: H3Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140789
Gene: ENSMUSG00000026219
AA Change: H3Q

Domain	Start	End	E-Value	Type
low complexity region	138	149	N/A	INTRINSIC
low complexity region	150	167	N/A	INTRINSIC
Blast:HECTc	168	222	5e-8	BLAST
Blast:HECTc	378	434	1e-24	BLAST
HECTc	441	830	6.2e-180	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000189841

SMART Domains

Protein: ENSMUSP00000140879
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	1	24	N/A	INTRINSIC
low complexity region	51	63	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190125

Meta Mutation Damage Score

0.4708

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 94.9%
20x: 91.2%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc1	C	A	16: 14,445,449	R758S	probably benign	Het
Acnat1	A	T	4: 49,447,716	H288Q	possibly damaging	Het
Adamts1	T	C	16: 85,802,226	E162G	possibly damaging	Het
Akap11	A	G	14: 78,513,661	S429P	probably benign	Het
Alg14	T	C	3: 121,361,766	Y212H	probably damaging	Het
Cacna1g	T	C	11: 94,466,181	T97A	probably damaging	Het
Ccdc112	T	A	18: 46,287,754	N310Y	possibly damaging	Het
Cenpl	A	T	1: 161,086,004	Y328F	probably damaging	Het
Cep162	G	A	9: 87,204,080	H1064Y	probably benign	Het
Cnksr3	T	A	10: 7,154,324	E126D	probably benign	Het
Ctsh	T	A	9: 90,061,565	M81K	probably benign	Het
D6Wsu163e	A	G	6: 126,955,149	T284A	probably damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dnaaf1	T	A	8: 119,582,877	M196K	probably benign	Het
Dnah9	C	A	11: 65,834,386	G4314C	probably damaging	Het
Dph1	A	G	11: 75,179,731	Y361H	probably damaging	Het
Ect2	C	T	3: 27,150,072	M29I	probably benign	Het
Eif3h	T	C	15: 51,797,670	Y167C	probably damaging	Het
Epc2	C	T	2: 49,532,089	R332C	probably damaging	Het
Fras1	C	A	5: 96,749,423		probably null	Het
Gfm2	A	G	13: 97,162,934	I386V	probably benign	Het
Gpd1l	G	A	9: 114,914,331	T167I	probably damaging	Het
Hsph1	T	A	5: 149,623,485	K567*	probably null	Het
Igfn1	T	G	1: 135,969,388	S1147R	probably benign	Het
Itgb4	T	C	11: 115,983,764	V406A	probably benign	Het
Kcna2	A	G	3: 107,105,113	I337V	possibly damaging	Het
Kcnab1	T	C	3: 65,302,194		probably null	Het
Kri1	G	T	9: 21,280,492		probably benign	Het
Lrguk	T	A	6: 34,133,387	I801K	possibly damaging	Het
Magi2	A	T	5: 20,602,460	N871Y	probably damaging	Het
Map3k10	G	T	7: 27,661,556		probably null	Het
Mrps25	T	C	6: 92,178,740	T71A	probably damaging	Het
Myo15	G	A	11: 60,499,495	W945*	probably null	Het
Ncan	A	T	8: 70,102,454	I1021N	probably damaging	Het
Ncf4	C	A	15: 78,250,382	S11R	probably benign	Het
Neb	A	C	2: 52,196,295	S5255R	possibly damaging	Het
Nop2	TGATGAAGATGAAGATGA	TGATGAAGATGA	6: 125,137,079		probably benign	Het
Olfr1155	T	C	2: 87,942,721		probably null	Het
Olfr1189	G	A	2: 88,592,172	A123T	probably damaging	Het
Olfr992	A	T	2: 85,400,441	F31I	probably damaging	Het
Pacs1	T	C	19: 5,153,714	I328V	probably damaging	Het
Pafah2	GCCCC	GCCCCC	4: 134,425,541		probably null	Het
Pan2	A	G	10: 128,304,378	H56R	possibly damaging	Het
Pigo	G	A	4: 43,024,710	R124*	probably null	Het
Ppfia2	A	G	10: 106,927,710	D1188G	probably benign	Het
Ppp1r16b	A	G	2: 158,761,435	N327D	probably damaging	Het
Psd3	A	G	8: 67,720,004	C223R	possibly damaging	Het
Rad50	A	G	11: 53,702,107	V72A	possibly damaging	Het
Rcor3	T	A	1: 192,100,833	D445V	possibly damaging	Het
Rundc1	T	A	11: 101,433,681	H404Q	probably benign	Het
Ryr1	T	C	7: 29,079,811	K2083E	probably benign	Het
Scd3	C	A	19: 44,235,842	H171Q	probably damaging	Het
Scrn2	T	C	11: 97,032,195	F155L	probably benign	Het
Serpina12	A	T	12: 104,032,510	L323Q	probably damaging	Het
Sptlc3	T	A	2: 139,625,923	M467K	probably benign	Het
Stard9	G	T	2: 120,698,489	R1742S	possibly damaging	Het
Thbd	A	T	2: 148,407,684	L88*	probably null	Het
Tln2	G	A	9: 67,362,687	Q477*	probably null	Het
Tnn	T	A	1: 160,116,182	E1020D	possibly damaging	Het
Vmn2r115	ATCTTCT	ATCT	17: 23,359,988		probably benign	Het
Vmp1	G	A	11: 86,643,587	Q165*	probably null	Het
Zfp758	T	A	17: 22,375,223	M230K	probably benign	Het

Other mutations in Trip12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Trip12	APN	1	84730541	missense	probably damaging	1.00
IGL00430:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00465:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00819:Trip12	APN	1	84754272	missense	probably damaging	1.00
IGL00900:Trip12	APN	1	84724764	missense	possibly damaging	0.56
IGL00990:Trip12	APN	1	84751884	missense	probably damaging	0.99
IGL01087:Trip12	APN	1	84757859	missense	probably damaging	0.99
IGL01400:Trip12	APN	1	84751978	missense	probably damaging	0.99
IGL01521:Trip12	APN	1	84766198	splice site	probably benign
IGL01619:Trip12	APN	1	84814910	missense	probably damaging	0.99
IGL01796:Trip12	APN	1	84728278	missense	probably benign	0.42
IGL01975:Trip12	APN	1	84814813	splice site	probably benign
IGL02190:Trip12	APN	1	84766070	missense	probably damaging	0.98
IGL02474:Trip12	APN	1	84794133	missense	probably benign
IGL02517:Trip12	APN	1	84743814	unclassified	probably benign
IGL02631:Trip12	APN	1	84766008	missense	possibly damaging	0.91
IGL02991:Trip12	APN	1	84738815	missense	probably damaging	1.00
IGL03161:Trip12	APN	1	84761132	unclassified	probably benign
IGL03388:Trip12	APN	1	84743186	missense	probably damaging	0.99
cardamom	UTSW	1	84749276	missense	probably damaging	0.99
pungent	UTSW	1	84793915	missense	possibly damaging	0.70
spices	UTSW	1	84793875	missense	probably benign	0.10
sulfuric	UTSW	1	84759050	missense	probably benign	0.19
Turmeric	UTSW	1	84754343	missense	probably benign	0.07
LCD18:Trip12	UTSW	1	84754482	unclassified	probably benign
R0090:Trip12	UTSW	1	84732136	splice site	probably benign
R0111:Trip12	UTSW	1	84759133	unclassified	probably benign
R0471:Trip12	UTSW	1	84726207	missense	probably damaging	1.00
R0486:Trip12	UTSW	1	84761084	nonsense	probably null
R0557:Trip12	UTSW	1	84724747	missense	probably damaging	1.00
R0570:Trip12	UTSW	1	84751548	missense	probably damaging	1.00
R0614:Trip12	UTSW	1	84757761	missense	probably damaging	1.00
R0627:Trip12	UTSW	1	84768597	missense	probably damaging	1.00
R0630:Trip12	UTSW	1	84793915	missense	possibly damaging	0.70
R0657:Trip12	UTSW	1	84759050	missense	probably benign	0.19
R0741:Trip12	UTSW	1	84745181	missense	probably benign	0.09
R0862:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R0864:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R1124:Trip12	UTSW	1	84737037	missense	probably damaging	1.00
R1252:Trip12	UTSW	1	84776350	nonsense	probably null
R1455:Trip12	UTSW	1	84759100	missense	probably benign	0.01
R1487:Trip12	UTSW	1	84768631	missense	probably damaging	1.00
R1702:Trip12	UTSW	1	84745063	missense	probably damaging	1.00
R1781:Trip12	UTSW	1	84730621	missense	probably benign	0.01
R1854:Trip12	UTSW	1	84728145	missense	probably damaging	1.00
R1866:Trip12	UTSW	1	84745060	missense	probably damaging	1.00
R1926:Trip12	UTSW	1	84749291	missense	probably damaging	0.98
R1935:Trip12	UTSW	1	84794101	missense	possibly damaging	0.46
R1950:Trip12	UTSW	1	84760801	missense	probably damaging	1.00
R1994:Trip12	UTSW	1	84749172	missense	probably damaging	1.00
R2014:Trip12	UTSW	1	84760866	nonsense	probably null
R2391:Trip12	UTSW	1	84814790	frame shift	probably null
R2423:Trip12	UTSW	1	84814790	frame shift	probably null
R2433:Trip12	UTSW	1	84743823	missense	possibly damaging	0.84
R2905:Trip12	UTSW	1	84754343	missense	probably benign	0.07
R3040:Trip12	UTSW	1	84742245	missense	probably benign	0.13
R3735:Trip12	UTSW	1	84814790	frame shift	probably null
R3907:Trip12	UTSW	1	84732106	missense	possibly damaging	0.53
R4394:Trip12	UTSW	1	84725741	missense	probably damaging	1.00
R4540:Trip12	UTSW	1	84749276	missense	probably damaging	0.99
R4859:Trip12	UTSW	1	84793810	missense	probably damaging	0.99
R5240:Trip12	UTSW	1	84794133	missense	probably benign
R5278:Trip12	UTSW	1	84762147	missense	probably damaging	1.00
R5377:Trip12	UTSW	1	84757431	missense	probably damaging	1.00
R5510:Trip12	UTSW	1	84768680	missense	probably damaging	1.00
R5542:Trip12	UTSW	1	84749344	missense	probably damaging	1.00
R5550:Trip12	UTSW	1	84761099	missense	probably damaging	0.99
R5886:Trip12	UTSW	1	84730458	intron	probably benign
R5893:Trip12	UTSW	1	84759163	unclassified	probably benign
R5914:Trip12	UTSW	1	84763458	missense	probably damaging	1.00
R5925:Trip12	UTSW	1	84749253	nonsense	probably null
R5985:Trip12	UTSW	1	84725771	missense	probably damaging	0.99
R6135:Trip12	UTSW	1	84760838	missense	probably benign	0.00
R6158:Trip12	UTSW	1	84761012	missense	possibly damaging	0.84
R6419:Trip12	UTSW	1	84793870	missense	probably damaging	1.00
R6816:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7144:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7194:Trip12	UTSW	1	84794222	missense	probably benign	0.07
R7355:Trip12	UTSW	1	84814883	missense	probably damaging	1.00
R7361:Trip12	UTSW	1	84750442	missense	probably damaging	0.98
R7588:Trip12	UTSW	1	84760883	missense	probably damaging	0.99
R7705:Trip12	UTSW	1	84777449	missense	probably damaging	1.00
R7818:Trip12	UTSW	1	84760806	missense	probably damaging	1.00
R7918:Trip12	UTSW	1	84745063	missense	probably damaging	0.98
R8127:Trip12	UTSW	1	84738742	missense	probably damaging	0.99
R8221:Trip12	UTSW	1	84766050	missense	possibly damaging	0.80
R8336:Trip12	UTSW	1	84766041	missense	probably benign	0.37
R8373:Trip12	UTSW	1	84795767	missense	probably damaging	0.98
R8719:Trip12	UTSW	1	84745069	missense	probably damaging	0.98
R8771:Trip12	UTSW	1	84743297	unclassified	probably benign
R8997:Trip12	UTSW	1	84793875	missense	probably benign	0.10
R9146:Trip12	UTSW	1	84794160	missense	possibly damaging	0.89
R9236:Trip12	UTSW	1	84725829	missense	probably damaging	1.00
R9338:Trip12	UTSW	1	84749298	missense	probably damaging	0.99
R9391:Trip12	UTSW	1	84795752	missense	probably benign	0.00
R9516:Trip12	UTSW	1	84757494	missense	probably damaging	1.00
X0023:Trip12	UTSW	1	84760787	missense	probably benign	0.12
X0065:Trip12	UTSW	1	84749163	missense	probably benign	0.21
Z1088:Trip12	UTSW	1	84766168	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGACACAAATACATCCACTTGCTAG -3'
(R):5'- ACATAGTGACCCTTCCAGATAATG -3'

Sequencing Primer
(F):5'- AGCTCTGACTCTTAGTACCCATGAG -3'
(R):5'- GATCTAAGCCCAGTAGTGCTCTAG -3'

Posted On

2014-06-23