Mutagenetix > Incidental Mutations

Incidental Mutation 'R1847:Sptlc3'

207781

Institutional Source

Beutler Lab

Gene Symbol

Sptlc3

Ensembl Gene

ENSMUSG00000039092

Gene Name

serine palmitoyltransferase, long chain base subunit 3

Synonyms

MMRRC Submission

039872-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.093) question?

Stock #

R1847 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

139493913-139637674 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 139625923 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 467 (M467K)

Ref Sequence

ENSEMBL: ENSMUSP00000105710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047370] [ENSMUST00000110083]

AlphaFold

Q8BG54

Predicted Effect

probably benign
Transcript: ENSMUST00000047370
AA Change: M467K

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000048313
Gene: ENSMUSG00000039092
AA Change: M467K

Domain	Start	End	E-Value	Type
transmembrane domain	60	79	N/A	INTRINSIC
Pfam:Aminotran_1_2	160	520	4.8e-59	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110083
AA Change: M467K

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000105710
Gene: ENSMUSG00000039092
AA Change: M467K

Domain	Start	End	E-Value	Type
transmembrane domain	60	79	N/A	INTRINSIC
Pfam:Aminotran_1_2	160	520	4.8e-59	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134801

Meta Mutation Damage Score

0.1099

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 94.9%
20x: 91.2%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The SPTLC3 gene encodes an isoform of the third subunit of serine palmitoyltransferase (SPT; EC 2.3.1.50), which catalyzes the rate-limiting step of the de novo synthesis of sphingolipids (Hornemann et al., 2006 [PubMed 17023427]). SPT contains 2 main subunits: the common SPTLC1 subunit (MIM 605712) and either SPTLC2 (MIM 605713) or its isoform SPTLC2L (SPTLC3), depending on the tissue in which biosynthesis occurs (Hornemann et al., 2006 [PubMed 17023427]). There are also 2 highly related isoforms of a third subunit, SSSPTA (MIM 613540) and SSSPTB (MIM 610412), that confer acyl-CoA preference of the SPT enzyme and are essential for maximal enzyme activity (Han et al., 2009 [PubMed 19416851]).[supplied by OMIM, Nov 2010]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc1	C	A	16: 14,445,449	R758S	probably benign	Het
Acnat1	A	T	4: 49,447,716	H288Q	possibly damaging	Het
Adamts1	T	C	16: 85,802,226	E162G	possibly damaging	Het
Akap11	A	G	14: 78,513,661	S429P	probably benign	Het
Alg14	T	C	3: 121,361,766	Y212H	probably damaging	Het
Cacna1g	T	C	11: 94,466,181	T97A	probably damaging	Het
Ccdc112	T	A	18: 46,287,754	N310Y	possibly damaging	Het
Cenpl	A	T	1: 161,086,004	Y328F	probably damaging	Het
Cep162	G	A	9: 87,204,080	H1064Y	probably benign	Het
Cnksr3	T	A	10: 7,154,324	E126D	probably benign	Het
Ctsh	T	A	9: 90,061,565	M81K	probably benign	Het
D6Wsu163e	A	G	6: 126,955,149	T284A	probably damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dnaaf1	T	A	8: 119,582,877	M196K	probably benign	Het
Dnah9	C	A	11: 65,834,386	G4314C	probably damaging	Het
Dph1	A	G	11: 75,179,731	Y361H	probably damaging	Het
Ect2	C	T	3: 27,150,072	M29I	probably benign	Het
Eif3h	T	C	15: 51,797,670	Y167C	probably damaging	Het
Epc2	C	T	2: 49,532,089	R332C	probably damaging	Het
Fras1	C	A	5: 96,749,423		probably null	Het
Gfm2	A	G	13: 97,162,934	I386V	probably benign	Het
Gpd1l	G	A	9: 114,914,331	T167I	probably damaging	Het
Hsph1	T	A	5: 149,623,485	K567*	probably null	Het
Igfn1	T	G	1: 135,969,388	S1147R	probably benign	Het
Itgb4	T	C	11: 115,983,764	V406A	probably benign	Het
Kcna2	A	G	3: 107,105,113	I337V	possibly damaging	Het
Kcnab1	T	C	3: 65,302,194		probably null	Het
Kri1	G	T	9: 21,280,492		probably benign	Het
Lrguk	T	A	6: 34,133,387	I801K	possibly damaging	Het
Magi2	A	T	5: 20,602,460	N871Y	probably damaging	Het
Map3k10	G	T	7: 27,661,556		probably null	Het
Mrps25	T	C	6: 92,178,740	T71A	probably damaging	Het
Myo15	G	A	11: 60,499,495	W945*	probably null	Het
Ncan	A	T	8: 70,102,454	I1021N	probably damaging	Het
Ncf4	C	A	15: 78,250,382	S11R	probably benign	Het
Neb	A	C	2: 52,196,295	S5255R	possibly damaging	Het
Nop2	TGATGAAGATGAAGATGA	TGATGAAGATGA	6: 125,137,079		probably benign	Het
Olfr1155	T	C	2: 87,942,721		probably null	Het
Olfr1189	G	A	2: 88,592,172	A123T	probably damaging	Het
Olfr992	A	T	2: 85,400,441	F31I	probably damaging	Het
Pacs1	T	C	19: 5,153,714	I328V	probably damaging	Het
Pafah2	GCCCC	GCCCCC	4: 134,425,541		probably null	Het
Pan2	A	G	10: 128,304,378	H56R	possibly damaging	Het
Pigo	G	A	4: 43,024,710	R124*	probably null	Het
Ppfia2	A	G	10: 106,927,710	D1188G	probably benign	Het
Ppp1r16b	A	G	2: 158,761,435	N327D	probably damaging	Het
Psd3	A	G	8: 67,720,004	C223R	possibly damaging	Het
Rad50	A	G	11: 53,702,107	V72A	possibly damaging	Het
Rcor3	T	A	1: 192,100,833	D445V	possibly damaging	Het
Rundc1	T	A	11: 101,433,681	H404Q	probably benign	Het
Ryr1	T	C	7: 29,079,811	K2083E	probably benign	Het
Scd3	C	A	19: 44,235,842	H171Q	probably damaging	Het
Scrn2	T	C	11: 97,032,195	F155L	probably benign	Het
Serpina12	A	T	12: 104,032,510	L323Q	probably damaging	Het
Stard9	G	T	2: 120,698,489	R1742S	possibly damaging	Het
Thbd	A	T	2: 148,407,684	L88*	probably null	Het
Tln2	G	A	9: 67,362,687	Q477*	probably null	Het
Tnn	T	A	1: 160,116,182	E1020D	possibly damaging	Het
Trip12	A	T	1: 84,749,269	H3Q	probably damaging	Het
Vmn2r115	ATCTTCT	ATCT	17: 23,359,988		probably benign	Het
Vmp1	G	A	11: 86,643,587	Q165*	probably null	Het
Zfp758	T	A	17: 22,375,223	M230K	probably benign	Het

Other mutations in Sptlc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01392:Sptlc3	APN	2	139546421	missense	possibly damaging	0.55
IGL01537:Sptlc3	APN	2	139589695	missense	possibly damaging	0.95
IGL01996:Sptlc3	APN	2	139581504	splice site	probably benign
IGL02512:Sptlc3	APN	2	139547203	missense	probably damaging	1.00
IGL03278:Sptlc3	APN	2	139589659	missense	probably damaging	1.00
IGL03286:Sptlc3	APN	2	139589659	missense	probably damaging	1.00
R0266:Sptlc3	UTSW	2	139596037	missense	possibly damaging	0.93
R0362:Sptlc3	UTSW	2	139546555	splice site	probably benign
R1464:Sptlc3	UTSW	2	139547234	missense	probably benign	0.00
R1464:Sptlc3	UTSW	2	139547234	missense	probably benign	0.00
R1494:Sptlc3	UTSW	2	139589560	missense	possibly damaging	0.58
R1919:Sptlc3	UTSW	2	139566675	missense	possibly damaging	0.66
R2093:Sptlc3	UTSW	2	139625874	missense	possibly damaging	0.89
R2396:Sptlc3	UTSW	2	139566586	missense	probably benign	0.44
R2972:Sptlc3	UTSW	2	139589661	missense	probably damaging	1.00
R2973:Sptlc3	UTSW	2	139589661	missense	probably damaging	1.00
R2974:Sptlc3	UTSW	2	139589661	missense	probably damaging	1.00
R4601:Sptlc3	UTSW	2	139636680	missense	probably benign	0.01
R4602:Sptlc3	UTSW	2	139636680	missense	probably benign	0.01
R4610:Sptlc3	UTSW	2	139636680	missense	probably benign	0.01
R4745:Sptlc3	UTSW	2	139547167	missense	probably damaging	1.00
R4779:Sptlc3	UTSW	2	139589589	missense	probably benign	0.04
R4992:Sptlc3	UTSW	2	139596003	missense	probably benign	0.04
R5162:Sptlc3	UTSW	2	139631343	missense	probably benign	0.11
R5401:Sptlc3	UTSW	2	139636723	missense	possibly damaging	0.75
R5406:Sptlc3	UTSW	2	139546478	missense	probably benign	0.26
R5642:Sptlc3	UTSW	2	139546408	missense	probably damaging	0.96
R5840:Sptlc3	UTSW	2	139547206	missense	probably damaging	1.00
R6057:Sptlc3	UTSW	2	139581613	missense	probably damaging	0.99
R6376:Sptlc3	UTSW	2	139636772	missense	probably benign	0.21
R6852:Sptlc3	UTSW	2	139566586	missense	probably benign	0.44
R7026:Sptlc3	UTSW	2	139537688	missense	probably benign
R7412:Sptlc3	UTSW	2	139589617	missense	possibly damaging	0.75
R7516:Sptlc3	UTSW	2	139589518	missense	probably benign	0.11
R7733:Sptlc3	UTSW	2	139631368	missense	possibly damaging	0.77
R7826:Sptlc3	UTSW	2	139547195	missense	probably benign	0.44
R7949:Sptlc3	UTSW	2	139625875	missense	possibly damaging	0.81
R9224:Sptlc3	UTSW	2	139494234	missense	probably benign	0.17
R9237:Sptlc3	UTSW	2	139566685	missense	probably benign	0.40
R9319:Sptlc3	UTSW	2	139636810	missense	possibly damaging	0.65
R9330:Sptlc3	UTSW	2	139546503	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGTACTTGTGTCTGATCACCC -3'
(R):5'- GGCTTCTGAGAAGTCATGTGTC -3'

Sequencing Primer
(F):5'- GAGTTTGCCAGGTTGATCTAAC -3'
(R):5'- CTGAGGTCAGAACTCAAGTACCTC -3'

Posted On

2014-06-23