Incidental Mutation 'R1847:Ryr1'
ID207801
Institutional Source Beutler Lab
Gene Symbol Ryr1
Ensembl Gene ENSMUSG00000030592
Gene Nameryanodine receptor 1, skeletal muscle
Synonymsskrr, calcium release channel isoform 1, Ryr
MMRRC Submission 039872-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1847 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29003344-29125179 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29079811 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 2083 (K2083E)
Ref Sequence ENSEMBL: ENSMUSP00000149042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032813] [ENSMUST00000179893] [ENSMUST00000214374]
Predicted Effect probably benign
Transcript: ENSMUST00000032813
AA Change: K2076E

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000032813
Gene: ENSMUSG00000030592
AA Change: K2076E

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 441 645 1.2e-73 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 851 945 6.5e-33 PFAM
Pfam:RyR 965 1059 1.5e-30 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2158 2366 7e-66 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2735 2829 9.7e-34 PFAM
Pfam:RyR 2855 2943 5.7e-32 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3613 3642 2e-13 PDB
low complexity region 3681 3691 N/A INTRINSIC
low complexity region 3735 3760 N/A INTRINSIC
Pfam:RIH_assoc 3872 4004 1.9e-41 PFAM
low complexity region 4010 4023 N/A INTRINSIC
Pfam:EF-hand_8 4085 4136 9.8e-8 PFAM
transmembrane domain 4283 4305 N/A INTRINSIC
transmembrane domain 4318 4336 N/A INTRINSIC
transmembrane domain 4341 4363 N/A INTRINSIC
Pfam:RR_TM4-6 4377 4666 2e-86 PFAM
Pfam:Ion_trans 4761 4932 3.4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158594
Predicted Effect probably benign
Transcript: ENSMUST00000179893
AA Change: K2076E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000137123
Gene: ENSMUSG00000030592
AA Change: K2076E

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 443 638 4.5e-63 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 852 942 1.3e-37 PFAM
Pfam:RyR 966 1056 1.6e-28 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2160 2366 2.2e-68 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2736 2826 7.2e-31 PFAM
Pfam:RyR 2856 2940 5.6e-27 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3615 3644 2e-13 PDB
low complexity region 3683 3693 N/A INTRINSIC
low complexity region 3737 3762 N/A INTRINSIC
Pfam:RIH_assoc 3878 3996 6.2e-35 PFAM
low complexity region 4012 4025 N/A INTRINSIC
Pfam:EF-hand_8 4087 4137 1.8e-8 PFAM
transmembrane domain 4285 4307 N/A INTRINSIC
transmembrane domain 4320 4338 N/A INTRINSIC
transmembrane domain 4343 4365 N/A INTRINSIC
Pfam:RR_TM4-6 4379 4668 8.4e-76 PFAM
Pfam:Ion_trans 4763 4946 2.8e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180926
Predicted Effect probably benign
Transcript: ENSMUST00000214374
AA Change: K2083E

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1304 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation and a similar ENU-induced mutation are born with a rounded body shape, edema, thin and misshapened ribs, and abnormal muscle fibers. Mutants die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 C A 16: 14,445,449 R758S probably benign Het
Acnat1 A T 4: 49,447,716 H288Q possibly damaging Het
Adamts1 T C 16: 85,802,226 E162G possibly damaging Het
Akap11 A G 14: 78,513,661 S429P probably benign Het
Alg14 T C 3: 121,361,766 Y212H probably damaging Het
Cacna1g T C 11: 94,466,181 T97A probably damaging Het
Ccdc112 T A 18: 46,287,754 N310Y possibly damaging Het
Cenpl A T 1: 161,086,004 Y328F probably damaging Het
Cep162 G A 9: 87,204,080 H1064Y probably benign Het
Cnksr3 T A 10: 7,154,324 E126D probably benign Het
Ctsh T A 9: 90,061,565 M81K probably benign Het
D6Wsu163e A G 6: 126,955,149 T284A probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnaaf1 T A 8: 119,582,877 M196K probably benign Het
Dnah9 C A 11: 65,834,386 G4314C probably damaging Het
Dph1 A G 11: 75,179,731 Y361H probably damaging Het
Ect2 C T 3: 27,150,072 M29I probably benign Het
Eif3h T C 15: 51,797,670 Y167C probably damaging Het
Epc2 C T 2: 49,532,089 R332C probably damaging Het
Fras1 C A 5: 96,749,423 probably null Het
Gfm2 A G 13: 97,162,934 I386V probably benign Het
Gpd1l G A 9: 114,914,331 T167I probably damaging Het
Hsph1 T A 5: 149,623,485 K567* probably null Het
Igfn1 T G 1: 135,969,388 S1147R probably benign Het
Itgb4 T C 11: 115,983,764 V406A probably benign Het
Kcna2 A G 3: 107,105,113 I337V possibly damaging Het
Kcnab1 T C 3: 65,302,194 probably null Het
Kri1 G T 9: 21,280,492 probably benign Het
Lrguk T A 6: 34,133,387 I801K possibly damaging Het
Magi2 A T 5: 20,602,460 N871Y probably damaging Het
Map3k10 G T 7: 27,661,556 probably null Het
Mrps25 T C 6: 92,178,740 T71A probably damaging Het
Myo15 G A 11: 60,499,495 W945* probably null Het
Ncan A T 8: 70,102,454 I1021N probably damaging Het
Ncf4 C A 15: 78,250,382 S11R probably benign Het
Neb A C 2: 52,196,295 S5255R possibly damaging Het
Nop2 TGATGAAGATGAAGATGA TGATGAAGATGA 6: 125,137,079 probably benign Het
Olfr1155 T C 2: 87,942,721 probably null Het
Olfr1189 G A 2: 88,592,172 A123T probably damaging Het
Olfr992 A T 2: 85,400,441 F31I probably damaging Het
Pacs1 T C 19: 5,153,714 I328V probably damaging Het
Pafah2 GCCCC GCCCCC 4: 134,425,541 probably null Het
Pan2 A G 10: 128,304,378 H56R possibly damaging Het
Pigo G A 4: 43,024,710 R124* probably null Het
Ppfia2 A G 10: 106,927,710 D1188G probably benign Het
Ppp1r16b A G 2: 158,761,435 N327D probably damaging Het
Psd3 A G 8: 67,720,004 C223R possibly damaging Het
Rad50 A G 11: 53,702,107 V72A possibly damaging Het
Rcor3 T A 1: 192,100,833 D445V possibly damaging Het
Rundc1 T A 11: 101,433,681 H404Q probably benign Het
Scd3 C A 19: 44,235,842 H171Q probably damaging Het
Scrn2 T C 11: 97,032,195 F155L probably benign Het
Serpina12 A T 12: 104,032,510 L323Q probably damaging Het
Sptlc3 T A 2: 139,625,923 M467K probably benign Het
Stard9 G T 2: 120,698,489 R1742S possibly damaging Het
Thbd A T 2: 148,407,684 L88* probably null Het
Tln2 G A 9: 67,362,687 Q477* probably null Het
Tnn T A 1: 160,116,182 E1020D possibly damaging Het
Trip12 A T 1: 84,749,269 H3Q probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmp1 G A 11: 86,643,587 Q165* probably null Het
Zfp758 T A 17: 22,375,223 M230K probably benign Het
Other mutations in Ryr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ryr1 APN 7 29102810 missense probably damaging 1.00
IGL00335:Ryr1 APN 7 29124960 splice site probably null
IGL00427:Ryr1 APN 7 29104737 splice site probably benign
IGL00559:Ryr1 APN 7 29012242 splice site probably benign
IGL00803:Ryr1 APN 7 29069645 missense possibly damaging 0.95
IGL00886:Ryr1 APN 7 29024229 missense probably damaging 1.00
IGL00948:Ryr1 APN 7 29020195 missense possibly damaging 0.78
IGL01017:Ryr1 APN 7 29082543 missense probably damaging 0.99
IGL01116:Ryr1 APN 7 29100202 splice site probably benign
IGL01385:Ryr1 APN 7 29056985 missense probably damaging 1.00
IGL01482:Ryr1 APN 7 29052337 missense probably damaging 1.00
IGL01529:Ryr1 APN 7 29075227 missense probably damaging 1.00
IGL01543:Ryr1 APN 7 29091076 missense probably damaging 1.00
IGL01653:Ryr1 APN 7 29078597 missense probably damaging 0.99
IGL01701:Ryr1 APN 7 29059810 missense probably damaging 0.98
IGL02051:Ryr1 APN 7 29071658 missense probably benign 0.16
IGL02152:Ryr1 APN 7 29052015 missense possibly damaging 0.95
IGL02271:Ryr1 APN 7 29094047 missense probably benign 0.07
IGL02321:Ryr1 APN 7 29078696 missense probably damaging 1.00
IGL02448:Ryr1 APN 7 29105066 splice site probably benign
IGL02472:Ryr1 APN 7 29040844 missense probably damaging 1.00
IGL02544:Ryr1 APN 7 29115599 missense probably benign 0.24
IGL02666:Ryr1 APN 7 29019763 missense unknown
IGL02672:Ryr1 APN 7 29004519 unclassified probably benign
IGL02677:Ryr1 APN 7 29110608 missense probably benign 0.18
IGL02686:Ryr1 APN 7 29069550 splice site probably benign
IGL02751:Ryr1 APN 7 29078774 missense probably damaging 1.00
IGL02899:Ryr1 APN 7 29048795 missense possibly damaging 0.53
IGL02926:Ryr1 APN 7 29061540 missense probably damaging 1.00
IGL02950:Ryr1 APN 7 29097459 missense probably damaging 1.00
IGL02960:Ryr1 APN 7 29060053 missense probably damaging 1.00
IGL02968:Ryr1 APN 7 29043893 missense probably damaging 1.00
IGL03070:Ryr1 APN 7 29070659 missense probably damaging 1.00
IGL03091:Ryr1 APN 7 29083486 missense possibly damaging 0.85
IGL03100:Ryr1 APN 7 29104593 missense probably damaging 1.00
IGL03107:Ryr1 APN 7 29075199 missense probably damaging 1.00
IGL03117:Ryr1 APN 7 29102964 missense probably damaging 1.00
IGL03118:Ryr1 APN 7 29015786 missense unknown
IGL03146:Ryr1 APN 7 29094032 missense probably benign 0.09
IGL03165:Ryr1 APN 7 29105040 missense probably benign 0.22
IGL03220:Ryr1 APN 7 29059855 missense probably damaging 1.00
R0017:Ryr1 UTSW 7 29047542 missense probably damaging 1.00
R0066:Ryr1 UTSW 7 29005567 unclassified probably benign
R0066:Ryr1 UTSW 7 29005567 unclassified probably benign
R0069:Ryr1 UTSW 7 29110505 splice site probably benign
R0148:Ryr1 UTSW 7 29052035 missense probably damaging 0.99
R0266:Ryr1 UTSW 7 29040679 missense probably damaging 1.00
R0346:Ryr1 UTSW 7 29067588 splice site probably benign
R0387:Ryr1 UTSW 7 29083367 splice site probably benign
R0454:Ryr1 UTSW 7 29036075 missense probably damaging 0.99
R0494:Ryr1 UTSW 7 29003793 splice site probably benign
R0533:Ryr1 UTSW 7 29078780 missense probably damaging 1.00
R0585:Ryr1 UTSW 7 29036076 missense probably damaging 1.00
R0591:Ryr1 UTSW 7 29104795 missense possibly damaging 0.68
R0624:Ryr1 UTSW 7 29074609 missense probably damaging 1.00
R0662:Ryr1 UTSW 7 29100189 missense probably damaging 1.00
R0849:Ryr1 UTSW 7 29040679 missense probably damaging 1.00
R0961:Ryr1 UTSW 7 29009697 missense unknown
R1052:Ryr1 UTSW 7 29096258 missense probably damaging 0.96
R1218:Ryr1 UTSW 7 29086109 missense possibly damaging 0.79
R1340:Ryr1 UTSW 7 29116012 missense probably damaging 0.99
R1513:Ryr1 UTSW 7 29070621 missense probably damaging 1.00
R1543:Ryr1 UTSW 7 29083537 missense possibly damaging 0.67
R1566:Ryr1 UTSW 7 29092175 missense possibly damaging 0.95
R1572:Ryr1 UTSW 7 29062191 missense probably damaging 1.00
R1623:Ryr1 UTSW 7 29095490 missense probably damaging 1.00
R1632:Ryr1 UTSW 7 29094261 missense probably benign 0.03
R1661:Ryr1 UTSW 7 29101738 missense probably damaging 0.98
R1665:Ryr1 UTSW 7 29036078 missense probably damaging 1.00
R1678:Ryr1 UTSW 7 29116154 missense probably damaging 0.99
R1705:Ryr1 UTSW 7 29078564 missense probably damaging 1.00
R1712:Ryr1 UTSW 7 29047503 missense probably benign 0.25
R1720:Ryr1 UTSW 7 29101870 missense probably damaging 0.99
R1799:Ryr1 UTSW 7 29067621 missense probably damaging 1.00
R1860:Ryr1 UTSW 7 29009552 missense unknown
R1861:Ryr1 UTSW 7 29009552 missense unknown
R1921:Ryr1 UTSW 7 29054944 missense probably damaging 1.00
R1983:Ryr1 UTSW 7 29059472 missense possibly damaging 0.74
R2043:Ryr1 UTSW 7 29059631 missense probably damaging 0.99
R2089:Ryr1 UTSW 7 29086049 missense probably damaging 1.00
R2091:Ryr1 UTSW 7 29086049 missense probably damaging 1.00
R2091:Ryr1 UTSW 7 29086049 missense probably damaging 1.00
R2105:Ryr1 UTSW 7 29090150 missense probably damaging 0.99
R2175:Ryr1 UTSW 7 29068442 missense probably damaging 1.00
R2259:Ryr1 UTSW 7 29019741 missense unknown
R2291:Ryr1 UTSW 7 29098777 missense probably damaging 1.00
R2351:Ryr1 UTSW 7 29075293 missense probably benign 0.18
R2512:Ryr1 UTSW 7 29103542 missense possibly damaging 0.64
R2571:Ryr1 UTSW 7 29009562 missense unknown
R2571:Ryr1 UTSW 7 29036126 missense possibly damaging 0.94
R2885:Ryr1 UTSW 7 29074798 missense probably damaging 0.99
R2886:Ryr1 UTSW 7 29074798 missense probably damaging 0.99
R2889:Ryr1 UTSW 7 29078741 missense possibly damaging 0.76
R3051:Ryr1 UTSW 7 29053090 missense probably damaging 1.00
R3052:Ryr1 UTSW 7 29053090 missense probably damaging 1.00
R3053:Ryr1 UTSW 7 29053090 missense probably damaging 1.00
R3082:Ryr1 UTSW 7 29045646 missense probably damaging 1.00
R3103:Ryr1 UTSW 7 29074948 missense probably damaging 1.00
R3237:Ryr1 UTSW 7 29069650 critical splice acceptor site probably null
R3551:Ryr1 UTSW 7 29056997 missense probably damaging 1.00
R3552:Ryr1 UTSW 7 29056997 missense probably damaging 1.00
R3807:Ryr1 UTSW 7 29020152 missense probably damaging 1.00
R3815:Ryr1 UTSW 7 29072902 missense probably damaging 0.98
R4010:Ryr1 UTSW 7 29095124 missense probably benign 0.41
R4041:Ryr1 UTSW 7 29085931 missense possibly damaging 0.77
R4226:Ryr1 UTSW 7 29062151 nonsense probably null
R4257:Ryr1 UTSW 7 29082450 missense possibly damaging 0.93
R4328:Ryr1 UTSW 7 29083059 missense probably damaging 1.00
R4394:Ryr1 UTSW 7 29094242 missense possibly damaging 0.69
R4485:Ryr1 UTSW 7 29090156 missense probably damaging 0.97
R4550:Ryr1 UTSW 7 29098735 missense probably benign 0.05
R4554:Ryr1 UTSW 7 29105008 missense probably benign 0.03
R4562:Ryr1 UTSW 7 29074580 intron probably benign
R4642:Ryr1 UTSW 7 29086038 missense possibly damaging 0.91
R4669:Ryr1 UTSW 7 29059831 missense probably null 0.99
R4707:Ryr1 UTSW 7 29045662 missense probably damaging 1.00
R4766:Ryr1 UTSW 7 29085833 missense probably damaging 0.96
R4768:Ryr1 UTSW 7 29004821 unclassified probably benign
R4770:Ryr1 UTSW 7 29109282 missense probably damaging 0.99
R4780:Ryr1 UTSW 7 29095097 missense possibly damaging 0.85
R4927:Ryr1 UTSW 7 29019983 missense unknown
R4933:Ryr1 UTSW 7 29104298 missense probably damaging 1.00
R4934:Ryr1 UTSW 7 29068095 missense probably damaging 1.00
R4942:Ryr1 UTSW 7 29069573 missense probably damaging 0.98
R4960:Ryr1 UTSW 7 29078783 missense possibly damaging 0.82
R5007:Ryr1 UTSW 7 29069115 missense probably damaging 1.00
R5011:Ryr1 UTSW 7 29102809 splice site probably null
R5013:Ryr1 UTSW 7 29102809 splice site probably null
R5137:Ryr1 UTSW 7 29101858 missense possibly damaging 0.94
R5167:Ryr1 UTSW 7 29067693 missense probably damaging 1.00
R5239:Ryr1 UTSW 7 29036128 missense probably damaging 1.00
R5291:Ryr1 UTSW 7 29115598 missense probably benign 0.03
R5303:Ryr1 UTSW 7 29068482 missense probably damaging 1.00
R5386:Ryr1 UTSW 7 29117416 missense probably damaging 0.98
R5431:Ryr1 UTSW 7 29109812 missense probably benign 0.39
R5460:Ryr1 UTSW 7 29071961 missense probably damaging 1.00
R5463:Ryr1 UTSW 7 29024023 missense possibly damaging 0.79
R5503:Ryr1 UTSW 7 29069028 missense possibly damaging 0.87
R5541:Ryr1 UTSW 7 29086185 missense probably damaging 1.00
R5573:Ryr1 UTSW 7 29015723 missense unknown
R5575:Ryr1 UTSW 7 29078693 missense possibly damaging 0.77
R5610:Ryr1 UTSW 7 29111974 missense probably benign 0.05
R5658:Ryr1 UTSW 7 29091089 splice site probably null
R5918:Ryr1 UTSW 7 29009152 missense probably benign 0.39
R5926:Ryr1 UTSW 7 29104360 missense probably damaging 1.00
R5938:Ryr1 UTSW 7 29046865 missense probably damaging 1.00
R5939:Ryr1 UTSW 7 29116127 missense probably damaging 0.97
R5947:Ryr1 UTSW 7 29071924 missense probably null 0.98
R5991:Ryr1 UTSW 7 29104610 missense probably damaging 0.99
R5992:Ryr1 UTSW 7 29067637 missense probably damaging 1.00
R5996:Ryr1 UTSW 7 29024241 missense probably benign 0.38
R6075:Ryr1 UTSW 7 29087438 missense probably damaging 1.00
R6091:Ryr1 UTSW 7 29071973 missense probably benign 0.01
R6126:Ryr1 UTSW 7 29076239 missense probably null 1.00
R6147:Ryr1 UTSW 7 29085914 missense possibly damaging 0.88
R6235:Ryr1 UTSW 7 29116181 missense probably benign 0.07
R6279:Ryr1 UTSW 7 29087428 missense possibly damaging 0.93
R6381:Ryr1 UTSW 7 29075257 missense possibly damaging 0.87
R6441:Ryr1 UTSW 7 29059695 missense possibly damaging 0.95
R6443:Ryr1 UTSW 7 29077078 missense probably damaging 0.97
R6459:Ryr1 UTSW 7 29015654 missense probably benign 0.39
R6514:Ryr1 UTSW 7 29046841 missense probably damaging 1.00
R6563:Ryr1 UTSW 7 29095492 missense possibly damaging 0.92
R6660:Ryr1 UTSW 7 29038345 critical splice donor site probably null
R6746:Ryr1 UTSW 7 29117404 missense possibly damaging 0.56
R6785:Ryr1 UTSW 7 29064874 missense probably benign 0.12
R6800:Ryr1 UTSW 7 29024316 missense possibly damaging 0.95
R6939:Ryr1 UTSW 7 29052326 missense possibly damaging 0.91
R6980:Ryr1 UTSW 7 29109387 missense probably benign 0.03
R6995:Ryr1 UTSW 7 29094182 missense probably damaging 0.97
R7065:Ryr1 UTSW 7 29103643 missense probably damaging 1.00
R7123:Ryr1 UTSW 7 29046854 missense probably benign 0.37
R7238:Ryr1 UTSW 7 29095382 missense probably benign 0.24
R7240:Ryr1 UTSW 7 29052015 missense possibly damaging 0.95
R7300:Ryr1 UTSW 7 29059511 missense probably damaging 1.00
R7365:Ryr1 UTSW 7 29085755 missense probably benign 0.05
R7403:Ryr1 UTSW 7 29013867 missense probably benign 0.34
R7422:Ryr1 UTSW 7 29085870 missense probably benign 0.00
R7493:Ryr1 UTSW 7 29095205 missense probably benign 0.44
R7570:Ryr1 UTSW 7 29078585 missense probably damaging 0.98
X0021:Ryr1 UTSW 7 29061531 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCAGCCCACACATTAGG -3'
(R):5'- TGGGCTAATGAGTGAGTGAGTA -3'

Sequencing Primer
(F):5'- TTAGGCCACCTCTCCAAGC -3'
(R):5'- TGAGTGAGAGAATGAATGATTGAGTG -3'
Posted On2014-06-23