Mutagenetix > Incidental Mutation

Incidental Mutation 'R1847:Ncan'

207803

Institutional Source

Beutler Lab

Gene Symbol

Ncan

Ensembl Gene

ENSMUSG00000002341

Gene Name

neurocan

Synonyms

Cspg3, Cspg3-rs, neurocan, Tgfbit

MMRRC Submission

039872-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1847 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70093085-70120873 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70102454 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1021 (I1021N)

Ref Sequence

ENSEMBL: ENSMUSP00000002412 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002412]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000002412
AA Change: I1021N

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: I1021N

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	23	30	N/A	INTRINSIC
IG	43	157	9.63e-6	SMART
LINK	157	254	2.22e-56	SMART
LINK	258	356	4.72e-60	SMART
low complexity region	575	586	N/A	INTRINSIC
low complexity region	602	632	N/A	INTRINSIC
low complexity region	663	677	N/A	INTRINSIC
EGF	963	996	6.5e-5	SMART
EGF_CA	998	1034	9.77e-9	SMART
CLECT	1040	1161	1.97e-41	SMART
CCP	1167	1223	2.53e-12	SMART
low complexity region	1225	1256	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184696

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 94.9%
20x: 91.2%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc1	C	A	16: 14,445,449	R758S	probably benign	Het
Acnat1	A	T	4: 49,447,716	H288Q	possibly damaging	Het
Adamts1	T	C	16: 85,802,226	E162G	possibly damaging	Het
Akap11	A	G	14: 78,513,661	S429P	probably benign	Het
Alg14	T	C	3: 121,361,766	Y212H	probably damaging	Het
Cacna1g	T	C	11: 94,466,181	T97A	probably damaging	Het
Ccdc112	T	A	18: 46,287,754	N310Y	possibly damaging	Het
Cenpl	A	T	1: 161,086,004	Y328F	probably damaging	Het
Cep162	G	A	9: 87,204,080	H1064Y	probably benign	Het
Cnksr3	T	A	10: 7,154,324	E126D	probably benign	Het
Ctsh	T	A	9: 90,061,565	M81K	probably benign	Het
D6Wsu163e	A	G	6: 126,955,149	T284A	probably damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dnaaf1	T	A	8: 119,582,877	M196K	probably benign	Het
Dnah9	C	A	11: 65,834,386	G4314C	probably damaging	Het
Dph1	A	G	11: 75,179,731	Y361H	probably damaging	Het
Ect2	C	T	3: 27,150,072	M29I	probably benign	Het
Eif3h	T	C	15: 51,797,670	Y167C	probably damaging	Het
Epc2	C	T	2: 49,532,089	R332C	probably damaging	Het
Fras1	C	A	5: 96,749,423		probably null	Het
Gfm2	A	G	13: 97,162,934	I386V	probably benign	Het
Gpd1l	G	A	9: 114,914,331	T167I	probably damaging	Het
Hsph1	T	A	5: 149,623,485	K567*	probably null	Het
Igfn1	T	G	1: 135,969,388	S1147R	probably benign	Het
Itgb4	T	C	11: 115,983,764	V406A	probably benign	Het
Kcna2	A	G	3: 107,105,113	I337V	possibly damaging	Het
Kcnab1	T	C	3: 65,302,194		probably null	Het
Kri1	G	T	9: 21,280,492		probably benign	Het
Lrguk	T	A	6: 34,133,387	I801K	possibly damaging	Het
Magi2	A	T	5: 20,602,460	N871Y	probably damaging	Het
Map3k10	G	T	7: 27,661,556		probably null	Het
Mrps25	T	C	6: 92,178,740	T71A	probably damaging	Het
Myo15	G	A	11: 60,499,495	W945*	probably null	Het
Ncf4	C	A	15: 78,250,382	S11R	probably benign	Het
Neb	A	C	2: 52,196,295	S5255R	possibly damaging	Het
Nop2	TGATGAAGATGAAGATGA	TGATGAAGATGA	6: 125,137,079		probably benign	Het
Olfr1155	T	C	2: 87,942,721		probably null	Het
Olfr1189	G	A	2: 88,592,172	A123T	probably damaging	Het
Olfr992	A	T	2: 85,400,441	F31I	probably damaging	Het
Pacs1	T	C	19: 5,153,714	I328V	probably damaging	Het
Pafah2	GCCCC	GCCCCC	4: 134,425,541		probably null	Het
Pan2	A	G	10: 128,304,378	H56R	possibly damaging	Het
Pigo	G	A	4: 43,024,710	R124*	probably null	Het
Ppfia2	A	G	10: 106,927,710	D1188G	probably benign	Het
Ppp1r16b	A	G	2: 158,761,435	N327D	probably damaging	Het
Psd3	A	G	8: 67,720,004	C223R	possibly damaging	Het
Rad50	A	G	11: 53,702,107	V72A	possibly damaging	Het
Rcor3	T	A	1: 192,100,833	D445V	possibly damaging	Het
Rundc1	T	A	11: 101,433,681	H404Q	probably benign	Het
Ryr1	T	C	7: 29,079,811	K2083E	probably benign	Het
Scd3	C	A	19: 44,235,842	H171Q	probably damaging	Het
Scrn2	T	C	11: 97,032,195	F155L	probably benign	Het
Serpina12	A	T	12: 104,032,510	L323Q	probably damaging	Het
Sptlc3	T	A	2: 139,625,923	M467K	probably benign	Het
Stard9	G	T	2: 120,698,489	R1742S	possibly damaging	Het
Thbd	A	T	2: 148,407,684	L88*	probably null	Het
Tln2	G	A	9: 67,362,687	Q477*	probably null	Het
Tnn	T	A	1: 160,116,182	E1020D	possibly damaging	Het
Trip12	A	T	1: 84,749,269	H3Q	probably damaging	Het
Vmn2r115	ATCTTCT	ATCT	17: 23,359,988		probably benign	Het
Vmp1	G	A	11: 86,643,587	Q165*	probably null	Het
Zfp758	T	A	17: 22,375,223	M230K	probably benign	Het

Other mutations in Ncan

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00539:Ncan	APN	8	70115271	missense	probably benign	0.24
IGL00924:Ncan	APN	8	70108389	missense	possibly damaging	0.78
IGL01319:Ncan	APN	8	70097562	missense	probably damaging	0.99
IGL01407:Ncan	APN	8	70101957	missense	probably benign	0.17
IGL01528:Ncan	APN	8	70110081	missense	probably benign	0.00
IGL01567:Ncan	APN	8	70108334	missense	probably benign	0.09
IGL01808:Ncan	APN	8	70107440	critical splice donor site	probably null
IGL02543:Ncan	APN	8	70108571	missense	probably benign	0.37
IGL02551:Ncan	APN	8	70102462	missense	probably damaging	1.00
IGL02899:Ncan	APN	8	70115048	missense	possibly damaging	0.95
IGL02940:Ncan	APN	8	70110085	missense	probably benign	0.02
IGL03058:Ncan	APN	8	70107932	missense	possibly damaging	0.83
learned	UTSW	8	70098081	nonsense	probably null
sagacious	UTSW	8	70112590	missense	probably damaging	0.99
R0219:Ncan	UTSW	8	70115334	missense	probably benign	0.08
R0538:Ncan	UTSW	8	70108602	missense	possibly damaging	0.86
R0540:Ncan	UTSW	8	70115159	missense	possibly damaging	0.93
R0854:Ncan	UTSW	8	70112552	missense	probably damaging	1.00
R0918:Ncan	UTSW	8	70108389	missense	possibly damaging	0.78
R1344:Ncan	UTSW	8	70108169	missense	probably benign
R1575:Ncan	UTSW	8	70110198	missense	probably benign	0.27
R1739:Ncan	UTSW	8	70108086	missense	probably benign	0.03
R1859:Ncan	UTSW	8	70115348	missense	possibly damaging	0.94
R2320:Ncan	UTSW	8	70108218	missense	probably benign
R2370:Ncan	UTSW	8	70112813	missense	probably benign	0.05
R3407:Ncan	UTSW	8	70112151	missense	probably damaging	1.00
R3408:Ncan	UTSW	8	70112151	missense	probably damaging	1.00
R3961:Ncan	UTSW	8	70110300	missense	probably benign	0.05
R4155:Ncan	UTSW	8	70110077	missense	possibly damaging	0.87
R4156:Ncan	UTSW	8	70110077	missense	possibly damaging	0.87
R4365:Ncan	UTSW	8	70115211	missense	probably damaging	1.00
R4858:Ncan	UTSW	8	70104055	missense	probably benign	0.00
R4925:Ncan	UTSW	8	70109954	missense	probably benign	0.02
R4942:Ncan	UTSW	8	70100294	missense	probably damaging	1.00
R4976:Ncan	UTSW	8	70115025	missense	probably damaging	0.98
R5119:Ncan	UTSW	8	70115025	missense	probably damaging	0.98
R5141:Ncan	UTSW	8	70112837	missense	probably damaging	1.00
R5679:Ncan	UTSW	8	70112626	missense	probably damaging	1.00
R5706:Ncan	UTSW	8	70102017	missense	probably damaging	0.99
R5915:Ncan	UTSW	8	70098081	nonsense	probably null
R6033:Ncan	UTSW	8	70112590	missense	probably damaging	0.99
R6033:Ncan	UTSW	8	70112590	missense	probably damaging	0.99
R6223:Ncan	UTSW	8	70109954	missense	probably benign	0.02
R6390:Ncan	UTSW	8	70115249	missense	probably benign	0.34
R6533:Ncan	UTSW	8	70096357	missense	probably benign	0.01
R6836:Ncan	UTSW	8	70100315	missense	possibly damaging	0.84
R6869:Ncan	UTSW	8	70107907	missense	probably benign	0.08
R7229:Ncan	UTSW	8	70100311	missense	possibly damaging	0.69
R7232:Ncan	UTSW	8	70112088	missense	probably damaging	1.00
R7293:Ncan	UTSW	8	70115211	missense	probably damaging	0.98
R7406:Ncan	UTSW	8	70110099	missense	probably benign	0.00
R7474:Ncan	UTSW	8	70102041	missense	possibly damaging	0.53
R7779:Ncan	UTSW	8	70115011	missense	probably damaging	0.99
R7973:Ncan	UTSW	8	70097575	missense	probably benign	0.00
R8113:Ncan	UTSW	8	70108571	missense	possibly damaging	0.58
R8269:Ncan	UTSW	8	70107680	missense	probably benign	0.01
R8947:Ncan	UTSW	8	70102521	missense	probably damaging	0.98
R9324:Ncan	UTSW	8	70107998	missense	possibly damaging	0.75
R9717:Ncan	UTSW	8	70101978	missense	probably damaging	1.00
R9803:Ncan	UTSW	8	70108101	missense	probably benign	0.06
Z1177:Ncan	UTSW	8	70097472	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ATGACACCCAGACAGACATGTG -3'
(R):5'- AGCAATCCCTGTGGGTATCC -3'

Sequencing Primer
(F):5'- TGATTGCCACCAAGTCTGAG -3'
(R):5'- CCTGTGGGTATCCAGGGGATG -3'

Posted On

2014-06-23