Incidental Mutation 'R1848:Cep350'
ID 207846
Institutional Source Beutler Lab
Gene Symbol Cep350
Ensembl Gene ENSMUSG00000033671
Gene Name centrosomal protein 350
Synonyms 4933409L06Rik, 6430546F08Rik
MMRRC Submission 039873-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.961) question?
Stock # R1848 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 155720710-155849001 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 155829397 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 169 (D169G)
Ref Sequence ENSEMBL: ENSMUSP00000120085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124495] [ENSMUST00000138762]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104231
Predicted Effect probably benign
Transcript: ENSMUST00000124495
AA Change: D109G

PolyPhen 2 Score 0.277 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000138762
AA Change: D169G

PolyPhen 2 Score 0.277 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120085
Gene: ENSMUSG00000033671
AA Change: D169G

DomainStartEndE-ValueType
low complexity region 251 265 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 481 491 N/A INTRINSIC
coiled coil region 596 641 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1250 1267 N/A INTRINSIC
coiled coil region 1363 1402 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1536 1546 N/A INTRINSIC
low complexity region 1694 1714 N/A INTRINSIC
coiled coil region 1732 1794 N/A INTRINSIC
low complexity region 1800 1811 N/A INTRINSIC
low complexity region 1819 1835 N/A INTRINSIC
coiled coil region 1853 1893 N/A INTRINSIC
low complexity region 1980 1994 N/A INTRINSIC
coiled coil region 2042 2092 N/A INTRINSIC
low complexity region 2383 2394 N/A INTRINSIC
low complexity region 2409 2421 N/A INTRINSIC
low complexity region 2470 2482 N/A INTRINSIC
CAP_GLY 2486 2551 5.91e-31 SMART
coiled coil region 2700 2731 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency 98% (120/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

 All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik C A 8: 88,295,121 (GRCm39) Y86* probably null Het
Aadac A G 3: 59,947,118 (GRCm39) E272G probably damaging Het
Abcc8 A T 7: 45,816,326 (GRCm39) D271E probably benign Het
Acan T C 7: 78,748,783 (GRCm39) F1185L probably benign Het
Adam1a A T 5: 121,657,683 (GRCm39) C537S probably damaging Het
Ago2 A G 15: 72,995,814 (GRCm39) V395A probably benign Het
Alox15 A G 11: 70,241,578 (GRCm39) V101A probably damaging Het
Ankra2 T C 13: 98,407,632 (GRCm39) I194T probably damaging Het
Apobec4 C A 1: 152,631,981 (GRCm39) P3H probably damaging Het
Arid3b G T 9: 57,703,960 (GRCm39) Y329* probably null Het
Atm A T 9: 53,379,312 (GRCm39) S1993T probably benign Het
Bpgm T G 6: 34,464,669 (GRCm39) S129A probably benign Het
Brat1 A G 5: 140,704,264 (GRCm39) D839G possibly damaging Het
Ccdc15 A T 9: 37,253,866 (GRCm39) S128T probably benign Het
Cd300lg A T 11: 101,937,032 (GRCm39) probably benign Het
Cdc34b C A 11: 94,633,303 (GRCm39) Q168K probably damaging Het
Celsr2 A T 3: 108,308,626 (GRCm39) V1767E probably benign Het
Col7a1 A T 9: 108,798,633 (GRCm39) D1762V possibly damaging Het
Coro7 A G 16: 4,448,298 (GRCm39) L724P probably damaging Het
Crb1 T A 1: 139,164,750 (GRCm39) I1125F probably damaging Het
Ctif T A 18: 75,653,012 (GRCm39) D415V probably damaging Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dhrs2 A G 14: 55,478,298 (GRCm39) D237G probably benign Het
Dhx9 T C 1: 153,341,499 (GRCm39) Q582R probably damaging Het
Dnajc1 C T 2: 18,224,524 (GRCm39) R443Q probably damaging Het
Dnm2 C T 9: 21,416,977 (GRCm39) R837W possibly damaging Het
Dpf2 C A 19: 5,956,643 (GRCm39) Q70H probably damaging Het
Dqx1 T A 6: 83,043,088 (GRCm39) D608E probably damaging Het
Dync2h1 T A 9: 7,049,166 (GRCm39) T3245S probably benign Het
Ect2l A G 10: 18,075,781 (GRCm39) L35P probably damaging Het
Efcab5 A T 11: 76,994,132 (GRCm39) L1285Q probably damaging Het
Eif4g1 G C 16: 20,500,617 (GRCm39) R697P probably damaging Het
Emsy T A 7: 98,250,028 (GRCm39) E753V probably damaging Het
Entpd3 A G 9: 120,387,485 (GRCm39) I227M probably damaging Het
Epn1 T A 7: 5,092,997 (GRCm39) V103E probably damaging Het
Esrra T C 19: 6,889,378 (GRCm39) D337G probably benign Het
Fam83e A T 7: 45,378,193 (GRCm39) K406* probably null Het
Fam83e A T 7: 45,378,194 (GRCm39) K406M possibly damaging Het
Fat2 A G 11: 55,202,384 (GRCm39) I230T probably damaging Het
Fbxl16 A G 17: 26,035,420 (GRCm39) I6V probably benign Het
Fgf23 T C 6: 127,050,156 (GRCm39) I55T probably damaging Het
Fibcd1 T A 2: 31,711,561 (GRCm39) D288V probably damaging Het
Flnb T C 14: 7,892,113 (GRCm38) I594T probably damaging Het
Gabbr2 T C 4: 46,739,823 (GRCm39) E449G probably benign Het
Gbf1 T G 19: 46,260,476 (GRCm39) S1130A possibly damaging Het
Gipc3 T C 10: 81,177,099 (GRCm39) E157G probably damaging Het
Glra3 G T 8: 56,393,942 (GRCm39) A18S probably benign Het
Gm6625 A C 8: 89,873,462 (GRCm39) noncoding transcript Het
Gpx4 A G 10: 79,891,870 (GRCm39) probably benign Het
Grb10 A G 11: 11,896,029 (GRCm39) F264L possibly damaging Het
Grik3 T C 4: 125,587,931 (GRCm39) Y684H probably damaging Het
Gstp1 C T 19: 4,086,795 (GRCm39) probably benign Het
H2bc27 A T 11: 58,839,928 (GRCm39) I55F possibly damaging Het
Haus8 G A 8: 71,708,767 (GRCm39) probably benign Het
Hip1 G A 5: 135,463,995 (GRCm39) probably null Het
Hspbap1 T A 16: 35,639,134 (GRCm39) probably null Het
Htr2b T A 1: 86,027,151 (GRCm39) I452F possibly damaging Het
Hydin T A 8: 111,296,440 (GRCm39) H3656Q probably benign Het
Klb T A 5: 65,506,180 (GRCm39) D142E probably benign Het
Lamb3 A T 1: 193,016,924 (GRCm39) T777S possibly damaging Het
Lins1 C A 7: 66,364,070 (GRCm39) T650K probably damaging Het
Loxhd1 A G 18: 77,369,667 (GRCm39) K5R possibly damaging Het
Lpp G A 16: 24,580,405 (GRCm39) M40I probably damaging Het
Mia2 A T 12: 59,217,037 (GRCm39) probably benign Het
Miip A C 4: 147,947,549 (GRCm39) F204V probably damaging Het
Mmp21 T C 7: 133,278,882 (GRCm39) R323G probably benign Het
Mta3 T A 17: 84,062,980 (GRCm39) probably benign Het
Myh1 A G 11: 67,104,456 (GRCm39) K1004R probably benign Het
Myh14 T A 7: 44,281,853 (GRCm39) I810F probably damaging Het
Nbas A C 12: 13,463,598 (GRCm39) D1295A probably damaging Het
Niban3 T C 8: 72,056,413 (GRCm39) M371T possibly damaging Het
Npr2 T G 4: 43,632,384 (GRCm39) V67G probably benign Het
Oas1f C A 5: 120,993,492 (GRCm39) Q235K probably damaging Het
Or12d17 T A 17: 37,777,938 (GRCm39) S280R probably damaging Het
Or13a27 T A 7: 139,925,900 (GRCm39) M1L probably benign Het
Or1p1 G T 11: 74,180,039 (GRCm39) C189F probably damaging Het
Or52ae9 T C 7: 103,390,381 (GRCm39) N22S probably benign Het
Or7e166 C T 9: 19,624,386 (GRCm39) H88Y probably benign Het
Pafah2 GCCCC GCCCCC 4: 134,152,852 (GRCm39) probably null Het
Pde1b A G 15: 103,433,767 (GRCm39) probably null Het
Pdilt T C 7: 119,088,607 (GRCm39) T465A probably benign Het
Plxnd1 T C 6: 115,943,507 (GRCm39) H1233R probably damaging Het
Ppm1b T A 17: 85,301,552 (GRCm39) M144K probably benign Het
Prkdc T C 16: 15,625,922 (GRCm39) L3316S probably benign Het
Prm2 T A 16: 10,609,455 (GRCm39) probably benign Het
Prmt7 T C 8: 106,963,640 (GRCm39) V240A probably benign Het
Prx C A 7: 27,218,313 (GRCm39) A938E possibly damaging Het
Rbm7 A G 9: 48,402,194 (GRCm39) V131A probably benign Het
Ric1 T A 19: 29,578,213 (GRCm39) probably null Het
Rnf150 A T 8: 83,590,639 (GRCm39) M1L possibly damaging Het
Rnf20 C T 4: 49,644,628 (GRCm39) R298W probably damaging Het
Rp1 T A 1: 4,417,455 (GRCm39) Y1219F possibly damaging Het
Scn7a A G 2: 66,514,357 (GRCm39) probably null Het
Sdad1 A G 5: 92,440,510 (GRCm39) probably null Het
Septin9 T C 11: 117,243,909 (GRCm39) probably benign Het
Serinc3 T C 2: 163,487,409 (GRCm39) probably benign Het
Shc3 C T 13: 51,615,424 (GRCm39) G178R probably damaging Het
Slc4a10 A T 2: 62,146,950 (GRCm39) K1090M probably damaging Het
Slco1a1 T C 6: 141,868,837 (GRCm39) I376V probably benign Het
Slmap A T 14: 26,143,729 (GRCm39) F719L probably benign Het
Smgc A G 15: 91,743,956 (GRCm39) N573D possibly damaging Het
Spx G A 6: 142,359,805 (GRCm39) probably null Het
Srrt C G 5: 137,295,207 (GRCm39) E308Q probably damaging Het
Tas2r130 T A 6: 131,607,560 (GRCm39) R78S probably benign Het
Tchhl1 A G 3: 93,378,408 (GRCm39) R371G probably damaging Het
Teddm2 C T 1: 153,726,194 (GRCm39) A174T probably benign Het
Tktl2 G A 8: 66,964,999 (GRCm39) V186M probably damaging Het
Trim33 T C 3: 103,231,956 (GRCm39) probably benign Het
Tspan31 A G 10: 126,905,327 (GRCm39) V40A probably damaging Het
Uevld A G 7: 46,594,975 (GRCm39) probably benign Het
Vcl G T 14: 21,059,063 (GRCm39) A560S probably benign Het
Vmn2r24 T A 6: 123,793,183 (GRCm39) C837S probably damaging Het
Vmn2r57 C T 7: 41,077,531 (GRCm39) V212M probably damaging Het
Vps13c A G 9: 67,843,622 (GRCm39) T1968A probably benign Het
Vtn A G 11: 78,391,393 (GRCm39) R269G probably damaging Het
Wdcp G A 12: 4,900,245 (GRCm39) V34I possibly damaging Het
Zc3h14 A G 12: 98,719,091 (GRCm39) D152G possibly damaging Het
Zfp189 C T 4: 49,529,266 (GRCm39) P123L probably benign Het
Zfp318 T C 17: 46,716,981 (GRCm39) S1038P possibly damaging Het
Zfp873 A G 10: 81,896,406 (GRCm39) D416G probably benign Het
Other mutations in Cep350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Cep350 APN 1 155,816,492 (GRCm39) missense possibly damaging 0.68
IGL00821:Cep350 APN 1 155,737,950 (GRCm39) missense probably benign
IGL00837:Cep350 APN 1 155,829,137 (GRCm39) missense probably damaging 1.00
IGL00977:Cep350 APN 1 155,808,611 (GRCm39) missense probably null 0.99
IGL01544:Cep350 APN 1 155,828,933 (GRCm39) missense probably damaging 1.00
IGL01616:Cep350 APN 1 155,828,993 (GRCm39) missense probably benign 0.00
IGL01695:Cep350 APN 1 155,819,904 (GRCm39) missense probably damaging 1.00
IGL01902:Cep350 APN 1 155,737,731 (GRCm39) missense probably damaging 1.00
IGL01977:Cep350 APN 1 155,787,714 (GRCm39) missense probably benign 0.01
IGL02388:Cep350 APN 1 155,829,499 (GRCm39) missense probably benign 0.28
IGL02475:Cep350 APN 1 155,738,341 (GRCm39) missense probably damaging 1.00
IGL02528:Cep350 APN 1 155,770,361 (GRCm39) missense probably damaging 1.00
IGL02598:Cep350 APN 1 155,738,713 (GRCm39) missense probably benign 0.00
IGL02676:Cep350 APN 1 155,737,977 (GRCm39) missense possibly damaging 0.82
IGL02728:Cep350 APN 1 155,828,968 (GRCm39) missense probably benign 0.02
IGL02744:Cep350 APN 1 155,807,279 (GRCm39) missense probably damaging 0.98
IGL02817:Cep350 APN 1 155,804,588 (GRCm39) missense probably damaging 1.00
IGL02892:Cep350 APN 1 155,744,552 (GRCm39) missense possibly damaging 0.51
IGL03156:Cep350 APN 1 155,733,788 (GRCm39) missense probably damaging 1.00
IGL03166:Cep350 APN 1 155,739,346 (GRCm39) missense possibly damaging 0.78
IGL03216:Cep350 APN 1 155,736,373 (GRCm39) missense probably benign 0.06
IGL03268:Cep350 APN 1 155,829,295 (GRCm39) missense probably benign 0.16
IGL03358:Cep350 APN 1 155,804,285 (GRCm39) missense probably benign
primed UTSW 1 155,829,334 (GRCm39) missense probably damaging 0.98
stoked UTSW 1 155,791,321 (GRCm39) missense probably benign 0.03
NA:Cep350 UTSW 1 155,834,394 (GRCm39) missense probably damaging 1.00
R0060:Cep350 UTSW 1 155,804,372 (GRCm39) missense probably damaging 1.00
R0060:Cep350 UTSW 1 155,804,372 (GRCm39) missense probably damaging 1.00
R0066:Cep350 UTSW 1 155,786,964 (GRCm39) missense probably damaging 0.99
R0066:Cep350 UTSW 1 155,786,964 (GRCm39) missense probably damaging 0.99
R0172:Cep350 UTSW 1 155,829,193 (GRCm39) missense probably benign 0.00
R0365:Cep350 UTSW 1 155,782,317 (GRCm39) missense probably benign 0.00
R0472:Cep350 UTSW 1 155,790,469 (GRCm39) missense probably damaging 0.99
R0502:Cep350 UTSW 1 155,776,629 (GRCm39) splice site probably null
R0538:Cep350 UTSW 1 155,724,366 (GRCm39) missense possibly damaging 0.80
R0547:Cep350 UTSW 1 155,777,181 (GRCm39) splice site probably null
R0565:Cep350 UTSW 1 155,836,941 (GRCm39) splice site probably benign
R0607:Cep350 UTSW 1 155,747,794 (GRCm39) missense probably damaging 1.00
R0645:Cep350 UTSW 1 155,816,458 (GRCm39) splice site probably null
R0675:Cep350 UTSW 1 155,835,499 (GRCm39) missense possibly damaging 0.63
R0828:Cep350 UTSW 1 155,828,992 (GRCm39) missense probably benign 0.00
R0863:Cep350 UTSW 1 155,737,981 (GRCm39) missense probably benign 0.00
R0969:Cep350 UTSW 1 155,816,572 (GRCm39) missense possibly damaging 0.81
R1102:Cep350 UTSW 1 155,807,264 (GRCm39) missense probably damaging 1.00
R1186:Cep350 UTSW 1 155,751,122 (GRCm39) missense probably damaging 1.00
R1552:Cep350 UTSW 1 155,786,484 (GRCm39) missense possibly damaging 0.92
R1560:Cep350 UTSW 1 155,804,825 (GRCm39) missense possibly damaging 0.48
R1698:Cep350 UTSW 1 155,829,104 (GRCm39) missense possibly damaging 0.62
R1729:Cep350 UTSW 1 155,787,727 (GRCm39) missense probably benign 0.17
R1735:Cep350 UTSW 1 155,828,960 (GRCm39) missense probably damaging 0.99
R1740:Cep350 UTSW 1 155,804,579 (GRCm39) missense probably damaging 1.00
R1783:Cep350 UTSW 1 155,804,611 (GRCm39) missense probably damaging 1.00
R1844:Cep350 UTSW 1 155,724,374 (GRCm39) missense probably damaging 0.99
R1988:Cep350 UTSW 1 155,808,850 (GRCm39) missense possibly damaging 0.82
R2008:Cep350 UTSW 1 155,790,467 (GRCm39) missense probably benign 0.16
R2241:Cep350 UTSW 1 155,834,302 (GRCm39) splice site probably null
R2245:Cep350 UTSW 1 155,754,766 (GRCm39) missense probably benign 0.10
R2402:Cep350 UTSW 1 155,738,882 (GRCm39) missense probably benign
R2566:Cep350 UTSW 1 155,835,464 (GRCm39) critical splice donor site probably null
R3160:Cep350 UTSW 1 155,738,910 (GRCm39) missense probably benign 0.00
R3162:Cep350 UTSW 1 155,738,910 (GRCm39) missense probably benign 0.00
R3769:Cep350 UTSW 1 155,828,950 (GRCm39) missense probably damaging 1.00
R4035:Cep350 UTSW 1 155,835,541 (GRCm39) missense probably benign 0.06
R4158:Cep350 UTSW 1 155,808,621 (GRCm39) missense probably damaging 1.00
R4160:Cep350 UTSW 1 155,808,621 (GRCm39) missense probably damaging 1.00
R4213:Cep350 UTSW 1 155,811,707 (GRCm39) missense probably damaging 1.00
R4483:Cep350 UTSW 1 155,802,214 (GRCm39) missense probably benign 0.01
R4648:Cep350 UTSW 1 155,778,344 (GRCm39) missense possibly damaging 0.85
R4694:Cep350 UTSW 1 155,804,332 (GRCm39) missense probably damaging 1.00
R4836:Cep350 UTSW 1 155,804,579 (GRCm39) missense probably damaging 1.00
R4839:Cep350 UTSW 1 155,804,240 (GRCm39) missense probably benign 0.00
R4969:Cep350 UTSW 1 155,736,025 (GRCm39) missense probably damaging 0.99
R5014:Cep350 UTSW 1 155,803,952 (GRCm39) missense probably benign 0.00
R5027:Cep350 UTSW 1 155,809,100 (GRCm39) missense probably benign 0.01
R5144:Cep350 UTSW 1 155,786,896 (GRCm39) missense probably damaging 0.99
R5153:Cep350 UTSW 1 155,811,692 (GRCm39) missense probably damaging 1.00
R5165:Cep350 UTSW 1 155,804,114 (GRCm39) missense probably damaging 1.00
R5182:Cep350 UTSW 1 155,733,854 (GRCm39) missense probably damaging 1.00
R5445:Cep350 UTSW 1 155,770,469 (GRCm39) missense probably benign 0.01
R5738:Cep350 UTSW 1 155,741,824 (GRCm39) missense probably damaging 1.00
R5809:Cep350 UTSW 1 155,809,087 (GRCm39) missense probably damaging 0.98
R5855:Cep350 UTSW 1 155,829,508 (GRCm39) missense probably benign 0.00
R6103:Cep350 UTSW 1 155,800,322 (GRCm39) missense probably benign 0.05
R6139:Cep350 UTSW 1 155,829,025 (GRCm39) missense probably benign 0.03
R6285:Cep350 UTSW 1 155,829,120 (GRCm39) missense possibly damaging 0.48
R6430:Cep350 UTSW 1 155,770,419 (GRCm39) missense probably damaging 1.00
R6446:Cep350 UTSW 1 155,737,900 (GRCm39) missense probably benign
R6520:Cep350 UTSW 1 155,809,082 (GRCm39) missense probably benign 0.02
R6712:Cep350 UTSW 1 155,733,852 (GRCm39) missense possibly damaging 0.93
R6940:Cep350 UTSW 1 155,804,297 (GRCm39) missense probably benign 0.01
R7020:Cep350 UTSW 1 155,804,077 (GRCm39) missense probably damaging 1.00
R7056:Cep350 UTSW 1 155,724,373 (GRCm39) missense probably damaging 1.00
R7141:Cep350 UTSW 1 155,790,494 (GRCm39) missense probably damaging 1.00
R7215:Cep350 UTSW 1 155,770,453 (GRCm39) missense possibly damaging 0.89
R7247:Cep350 UTSW 1 155,786,499 (GRCm39) missense probably damaging 1.00
R7272:Cep350 UTSW 1 155,829,334 (GRCm39) missense probably damaging 0.98
R7336:Cep350 UTSW 1 155,738,022 (GRCm39) missense probably benign 0.17
R7361:Cep350 UTSW 1 155,777,237 (GRCm39) missense probably damaging 1.00
R7390:Cep350 UTSW 1 155,741,833 (GRCm39) missense possibly damaging 0.94
R7402:Cep350 UTSW 1 155,803,961 (GRCm39) missense probably benign 0.00
R7428:Cep350 UTSW 1 155,770,365 (GRCm39) missense probably benign 0.00
R7440:Cep350 UTSW 1 155,816,518 (GRCm39) missense probably damaging 0.98
R7520:Cep350 UTSW 1 155,791,375 (GRCm39) missense probably benign 0.05
R7529:Cep350 UTSW 1 155,737,669 (GRCm39) missense probably benign 0.08
R7635:Cep350 UTSW 1 155,754,767 (GRCm39) nonsense probably null
R7806:Cep350 UTSW 1 155,737,809 (GRCm39) missense probably benign 0.00
R8100:Cep350 UTSW 1 155,829,148 (GRCm39) missense probably damaging 0.97
R8192:Cep350 UTSW 1 155,816,529 (GRCm39) missense possibly damaging 0.94
R8193:Cep350 UTSW 1 155,737,825 (GRCm39) missense probably benign 0.01
R8351:Cep350 UTSW 1 155,747,780 (GRCm39) missense probably damaging 0.99
R8406:Cep350 UTSW 1 155,798,164 (GRCm39) missense probably benign 0.00
R8451:Cep350 UTSW 1 155,747,780 (GRCm39) missense probably damaging 0.99
R8467:Cep350 UTSW 1 155,791,321 (GRCm39) missense probably benign 0.03
R8543:Cep350 UTSW 1 155,738,122 (GRCm39) missense probably damaging 0.98
R8714:Cep350 UTSW 1 155,736,477 (GRCm39) missense probably damaging 0.98
R8810:Cep350 UTSW 1 155,803,862 (GRCm39) missense probably damaging 1.00
R8837:Cep350 UTSW 1 155,737,518 (GRCm39) missense probably benign 0.09
R8933:Cep350 UTSW 1 155,739,161 (GRCm39) missense probably benign 0.01
R9043:Cep350 UTSW 1 155,773,228 (GRCm39) missense probably damaging 1.00
R9050:Cep350 UTSW 1 155,738,687 (GRCm39) missense possibly damaging 0.81
R9067:Cep350 UTSW 1 155,737,485 (GRCm39) missense probably benign 0.00
R9105:Cep350 UTSW 1 155,835,561 (GRCm39) missense probably damaging 1.00
R9295:Cep350 UTSW 1 155,738,051 (GRCm39) nonsense probably null
R9304:Cep350 UTSW 1 155,829,464 (GRCm39) missense probably damaging 0.98
R9456:Cep350 UTSW 1 155,744,457 (GRCm39) missense probably benign 0.00
R9575:Cep350 UTSW 1 155,751,113 (GRCm39) missense probably benign 0.03
R9715:Cep350 UTSW 1 155,751,107 (GRCm39) missense probably benign 0.00
R9749:Cep350 UTSW 1 155,828,985 (GRCm39) missense probably benign 0.02
R9758:Cep350 UTSW 1 155,770,433 (GRCm39) missense probably damaging 0.96
R9767:Cep350 UTSW 1 155,739,018 (GRCm39) missense probably benign 0.01
RF020:Cep350 UTSW 1 155,791,224 (GRCm39) missense probably benign 0.34
X0018:Cep350 UTSW 1 155,829,032 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GAGAAGGCTTTGAATTGTTCTCAC -3'
(R):5'- TGGCTTCAGTTTGACTGCTC -3'

Sequencing Primer
(F):5'- CACTTCCTTTTGTTCTGTTAGGC -3'
(R):5'- GGATTGTGTAACCAAGCTCTTTC -3'
Posted On 2014-06-23