Incidental Mutation 'R1848:Brat1'
ID 207874
Institutional Source Beutler Lab
Gene Symbol Brat1
Ensembl Gene ENSMUSG00000000148
Gene Name BRCA1-associated ATM activator 1
Synonyms Baat1
MMRRC Submission 039873-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.304) question?
Stock # R1848 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 140690766-140705134 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 140704264 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 839 (D839G)
Ref Sequence ENSEMBL: ENSMUSP00000098074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041588] [ENSMUST00000100505] [ENSMUST00000110806] [ENSMUST00000153440]
AlphaFold Q8C3R1
Predicted Effect possibly damaging
Transcript: ENSMUST00000041588
AA Change: D794G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036016
Gene: ENSMUSG00000000148
AA Change: D794G

DomainStartEndE-ValueType
low complexity region 90 105 N/A INTRINSIC
low complexity region 402 413 N/A INTRINSIC
low complexity region 443 454 N/A INTRINSIC
low complexity region 486 498 N/A INTRINSIC
Pfam:HEAT 501 531 3e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100505
AA Change: D839G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098074
Gene: ENSMUSG00000000148
AA Change: D839G

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
low complexity region 135 150 N/A INTRINSIC
low complexity region 447 458 N/A INTRINSIC
low complexity region 488 499 N/A INTRINSIC
low complexity region 531 543 N/A INTRINSIC
Pfam:HEAT 546 576 4.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110806
SMART Domains Protein: ENSMUSP00000106429
Gene: ENSMUSG00000000148

DomainStartEndE-ValueType
low complexity region 90 105 N/A INTRINSIC
low complexity region 402 413 N/A INTRINSIC
low complexity region 443 454 N/A INTRINSIC
low complexity region 486 498 N/A INTRINSIC
Pfam:HEAT 501 531 4.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131905
Predicted Effect probably benign
Transcript: ENSMUST00000153440
SMART Domains Protein: ENSMUSP00000114216
Gene: ENSMUSG00000000148

DomainStartEndE-ValueType
SCOP:d1gw5a_ 2 172 2e-3 SMART
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency 98% (120/123)
MGI Phenotype FUNCTION: A similar gene in human encodes a Breast Cancer 1 (BRCA1) interacting protein that is involved in cell cycle checkpoint signaling. The similar human protein is localized to DNA double strand breaks caused by ionizing radiation, and regulates cellular DNA damage response through interactions with Ataxia Telangiectasia Mutated (ATM) and DNA-dependent Protein Kinase. A pseudogene of this gene is located on chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik C A 8: 88,295,121 (GRCm39) Y86* probably null Het
Aadac A G 3: 59,947,118 (GRCm39) E272G probably damaging Het
Abcc8 A T 7: 45,816,326 (GRCm39) D271E probably benign Het
Acan T C 7: 78,748,783 (GRCm39) F1185L probably benign Het
Adam1a A T 5: 121,657,683 (GRCm39) C537S probably damaging Het
Ago2 A G 15: 72,995,814 (GRCm39) V395A probably benign Het
Alox15 A G 11: 70,241,578 (GRCm39) V101A probably damaging Het
Ankra2 T C 13: 98,407,632 (GRCm39) I194T probably damaging Het
Apobec4 C A 1: 152,631,981 (GRCm39) P3H probably damaging Het
Arid3b G T 9: 57,703,960 (GRCm39) Y329* probably null Het
Atm A T 9: 53,379,312 (GRCm39) S1993T probably benign Het
Bpgm T G 6: 34,464,669 (GRCm39) S129A probably benign Het
Ccdc15 A T 9: 37,253,866 (GRCm39) S128T probably benign Het
Cd300lg A T 11: 101,937,032 (GRCm39) probably benign Het
Cdc34b C A 11: 94,633,303 (GRCm39) Q168K probably damaging Het
Celsr2 A T 3: 108,308,626 (GRCm39) V1767E probably benign Het
Cep350 T C 1: 155,829,397 (GRCm39) D169G probably benign Het
Col7a1 A T 9: 108,798,633 (GRCm39) D1762V possibly damaging Het
Coro7 A G 16: 4,448,298 (GRCm39) L724P probably damaging Het
Crb1 T A 1: 139,164,750 (GRCm39) I1125F probably damaging Het
Ctif T A 18: 75,653,012 (GRCm39) D415V probably damaging Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dhrs2 A G 14: 55,478,298 (GRCm39) D237G probably benign Het
Dhx9 T C 1: 153,341,499 (GRCm39) Q582R probably damaging Het
Dnajc1 C T 2: 18,224,524 (GRCm39) R443Q probably damaging Het
Dnm2 C T 9: 21,416,977 (GRCm39) R837W possibly damaging Het
Dpf2 C A 19: 5,956,643 (GRCm39) Q70H probably damaging Het
Dqx1 T A 6: 83,043,088 (GRCm39) D608E probably damaging Het
Dync2h1 T A 9: 7,049,166 (GRCm39) T3245S probably benign Het
Ect2l A G 10: 18,075,781 (GRCm39) L35P probably damaging Het
Efcab5 A T 11: 76,994,132 (GRCm39) L1285Q probably damaging Het
Eif4g1 G C 16: 20,500,617 (GRCm39) R697P probably damaging Het
Emsy T A 7: 98,250,028 (GRCm39) E753V probably damaging Het
Entpd3 A G 9: 120,387,485 (GRCm39) I227M probably damaging Het
Epn1 T A 7: 5,092,997 (GRCm39) V103E probably damaging Het
Esrra T C 19: 6,889,378 (GRCm39) D337G probably benign Het
Fam83e A T 7: 45,378,193 (GRCm39) K406* probably null Het
Fam83e A T 7: 45,378,194 (GRCm39) K406M possibly damaging Het
Fat2 A G 11: 55,202,384 (GRCm39) I230T probably damaging Het
Fbxl16 A G 17: 26,035,420 (GRCm39) I6V probably benign Het
Fgf23 T C 6: 127,050,156 (GRCm39) I55T probably damaging Het
Fibcd1 T A 2: 31,711,561 (GRCm39) D288V probably damaging Het
Flnb T C 14: 7,892,113 (GRCm38) I594T probably damaging Het
Gabbr2 T C 4: 46,739,823 (GRCm39) E449G probably benign Het
Gbf1 T G 19: 46,260,476 (GRCm39) S1130A possibly damaging Het
Gipc3 T C 10: 81,177,099 (GRCm39) E157G probably damaging Het
Glra3 G T 8: 56,393,942 (GRCm39) A18S probably benign Het
Gm6625 A C 8: 89,873,462 (GRCm39) noncoding transcript Het
Gpx4 A G 10: 79,891,870 (GRCm39) probably benign Het
Grb10 A G 11: 11,896,029 (GRCm39) F264L possibly damaging Het
Grik3 T C 4: 125,587,931 (GRCm39) Y684H probably damaging Het
Gstp1 C T 19: 4,086,795 (GRCm39) probably benign Het
H2bc27 A T 11: 58,839,928 (GRCm39) I55F possibly damaging Het
Haus8 G A 8: 71,708,767 (GRCm39) probably benign Het
Hip1 G A 5: 135,463,995 (GRCm39) probably null Het
Hspbap1 T A 16: 35,639,134 (GRCm39) probably null Het
Htr2b T A 1: 86,027,151 (GRCm39) I452F possibly damaging Het
Hydin T A 8: 111,296,440 (GRCm39) H3656Q probably benign Het
Klb T A 5: 65,506,180 (GRCm39) D142E probably benign Het
Lamb3 A T 1: 193,016,924 (GRCm39) T777S possibly damaging Het
Lins1 C A 7: 66,364,070 (GRCm39) T650K probably damaging Het
Loxhd1 A G 18: 77,369,667 (GRCm39) K5R possibly damaging Het
Lpp G A 16: 24,580,405 (GRCm39) M40I probably damaging Het
Mia2 A T 12: 59,217,037 (GRCm39) probably benign Het
Miip A C 4: 147,947,549 (GRCm39) F204V probably damaging Het
Mmp21 T C 7: 133,278,882 (GRCm39) R323G probably benign Het
Mta3 T A 17: 84,062,980 (GRCm39) probably benign Het
Myh1 A G 11: 67,104,456 (GRCm39) K1004R probably benign Het
Myh14 T A 7: 44,281,853 (GRCm39) I810F probably damaging Het
Nbas A C 12: 13,463,598 (GRCm39) D1295A probably damaging Het
Niban3 T C 8: 72,056,413 (GRCm39) M371T possibly damaging Het
Npr2 T G 4: 43,632,384 (GRCm39) V67G probably benign Het
Oas1f C A 5: 120,993,492 (GRCm39) Q235K probably damaging Het
Or12d17 T A 17: 37,777,938 (GRCm39) S280R probably damaging Het
Or13a27 T A 7: 139,925,900 (GRCm39) M1L probably benign Het
Or1p1 G T 11: 74,180,039 (GRCm39) C189F probably damaging Het
Or52ae9 T C 7: 103,390,381 (GRCm39) N22S probably benign Het
Or7e166 C T 9: 19,624,386 (GRCm39) H88Y probably benign Het
Pafah2 GCCCC GCCCCC 4: 134,152,852 (GRCm39) probably null Het
Pde1b A G 15: 103,433,767 (GRCm39) probably null Het
Pdilt T C 7: 119,088,607 (GRCm39) T465A probably benign Het
Plxnd1 T C 6: 115,943,507 (GRCm39) H1233R probably damaging Het
Ppm1b T A 17: 85,301,552 (GRCm39) M144K probably benign Het
Prkdc T C 16: 15,625,922 (GRCm39) L3316S probably benign Het
Prm2 T A 16: 10,609,455 (GRCm39) probably benign Het
Prmt7 T C 8: 106,963,640 (GRCm39) V240A probably benign Het
Prx C A 7: 27,218,313 (GRCm39) A938E possibly damaging Het
Rbm7 A G 9: 48,402,194 (GRCm39) V131A probably benign Het
Ric1 T A 19: 29,578,213 (GRCm39) probably null Het
Rnf150 A T 8: 83,590,639 (GRCm39) M1L possibly damaging Het
Rnf20 C T 4: 49,644,628 (GRCm39) R298W probably damaging Het
Rp1 T A 1: 4,417,455 (GRCm39) Y1219F possibly damaging Het
Scn7a A G 2: 66,514,357 (GRCm39) probably null Het
Sdad1 A G 5: 92,440,510 (GRCm39) probably null Het
Septin9 T C 11: 117,243,909 (GRCm39) probably benign Het
Serinc3 T C 2: 163,487,409 (GRCm39) probably benign Het
Shc3 C T 13: 51,615,424 (GRCm39) G178R probably damaging Het
Slc4a10 A T 2: 62,146,950 (GRCm39) K1090M probably damaging Het
Slco1a1 T C 6: 141,868,837 (GRCm39) I376V probably benign Het
Slmap A T 14: 26,143,729 (GRCm39) F719L probably benign Het
Smgc A G 15: 91,743,956 (GRCm39) N573D possibly damaging Het
Spx G A 6: 142,359,805 (GRCm39) probably null Het
Srrt C G 5: 137,295,207 (GRCm39) E308Q probably damaging Het
Tas2r130 T A 6: 131,607,560 (GRCm39) R78S probably benign Het
Tchhl1 A G 3: 93,378,408 (GRCm39) R371G probably damaging Het
Teddm2 C T 1: 153,726,194 (GRCm39) A174T probably benign Het
Tktl2 G A 8: 66,964,999 (GRCm39) V186M probably damaging Het
Trim33 T C 3: 103,231,956 (GRCm39) probably benign Het
Tspan31 A G 10: 126,905,327 (GRCm39) V40A probably damaging Het
Uevld A G 7: 46,594,975 (GRCm39) probably benign Het
Vcl G T 14: 21,059,063 (GRCm39) A560S probably benign Het
Vmn2r24 T A 6: 123,793,183 (GRCm39) C837S probably damaging Het
Vmn2r57 C T 7: 41,077,531 (GRCm39) V212M probably damaging Het
Vps13c A G 9: 67,843,622 (GRCm39) T1968A probably benign Het
Vtn A G 11: 78,391,393 (GRCm39) R269G probably damaging Het
Wdcp G A 12: 4,900,245 (GRCm39) V34I possibly damaging Het
Zc3h14 A G 12: 98,719,091 (GRCm39) D152G possibly damaging Het
Zfp189 C T 4: 49,529,266 (GRCm39) P123L probably benign Het
Zfp318 T C 17: 46,716,981 (GRCm39) S1038P possibly damaging Het
Zfp873 A G 10: 81,896,406 (GRCm39) D416G probably benign Het
Other mutations in Brat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Brat1 APN 5 140,702,932 (GRCm39) missense probably damaging 1.00
IGL01327:Brat1 APN 5 140,703,963 (GRCm39) nonsense probably null
IGL01897:Brat1 APN 5 140,703,670 (GRCm39) missense probably benign 0.00
IGL01965:Brat1 APN 5 140,703,811 (GRCm39) missense probably benign 0.01
IGL02437:Brat1 APN 5 140,698,563 (GRCm39) missense possibly damaging 0.91
IGL03350:Brat1 APN 5 140,691,750 (GRCm39) missense probably damaging 1.00
R0394:Brat1 UTSW 5 140,704,141 (GRCm39) missense probably damaging 1.00
R1256:Brat1 UTSW 5 140,695,962 (GRCm39) missense possibly damaging 0.87
R1426:Brat1 UTSW 5 140,703,768 (GRCm39) missense probably benign 0.00
R1474:Brat1 UTSW 5 140,698,382 (GRCm39) missense probably benign
R2205:Brat1 UTSW 5 140,690,888 (GRCm39) intron probably benign
R3901:Brat1 UTSW 5 140,703,751 (GRCm39) missense possibly damaging 0.77
R3902:Brat1 UTSW 5 140,703,751 (GRCm39) missense possibly damaging 0.77
R4467:Brat1 UTSW 5 140,690,826 (GRCm39) utr 5 prime probably benign
R4751:Brat1 UTSW 5 140,704,051 (GRCm39) missense probably damaging 1.00
R5795:Brat1 UTSW 5 140,698,827 (GRCm39) missense probably benign 0.01
R6151:Brat1 UTSW 5 140,691,716 (GRCm39) missense probably benign 0.00
R7162:Brat1 UTSW 5 140,696,004 (GRCm39) missense probably benign 0.00
R8247:Brat1 UTSW 5 140,698,893 (GRCm39) missense possibly damaging 0.88
R8901:Brat1 UTSW 5 140,698,608 (GRCm39) missense probably benign 0.17
R8934:Brat1 UTSW 5 140,696,004 (GRCm39) missense probably benign 0.00
R9742:Brat1 UTSW 5 140,703,912 (GRCm39) missense probably benign 0.00
R9797:Brat1 UTSW 5 140,704,273 (GRCm39) missense probably damaging 1.00
X0026:Brat1 UTSW 5 140,700,693 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAAAAGGCCTGTGACCTGC -3'
(R):5'- CTGCAGGGTCTCTTGAGCTG -3'

Sequencing Primer
(F):5'- AGACAGTTCCCTGCAGTAGC -3'
(R):5'- CAGGGTCTCTTGAGCTGCTGAC -3'
Posted On 2014-06-23