Incidental Mutation 'R1848:Emsy'
ID 207893
Institutional Source Beutler Lab
Gene Symbol Emsy
Ensembl Gene ENSMUSG00000035401
Gene Name EMSY, BRCA2-interacting transcriptional repressor
Synonyms 2210018M11Rik
MMRRC Submission 039873-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock # R1848 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 98587137-98656783 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 98600821 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 753 (E753V)
Ref Sequence ENSEMBL: ENSMUSP00000145858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038359] [ENSMUST00000205276] [ENSMUST00000205886] [ENSMUST00000205911] [ENSMUST00000206619] [ENSMUST00000206626]
AlphaFold Q8BMB0
Predicted Effect probably damaging
Transcript: ENSMUST00000038359
AA Change: E753V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038216
Gene: ENSMUSG00000035401
AA Change: E753V

DomainStartEndE-ValueType
ENT 16 88 2.44e-29 SMART
low complexity region 94 104 N/A INTRINSIC
low complexity region 124 142 N/A INTRINSIC
low complexity region 226 248 N/A INTRINSIC
low complexity region 293 331 N/A INTRINSIC
low complexity region 363 406 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 681 698 N/A INTRINSIC
low complexity region 807 816 N/A INTRINSIC
low complexity region 866 882 N/A INTRINSIC
low complexity region 893 909 N/A INTRINSIC
low complexity region 1197 1208 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205276
AA Change: E753V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205485
Predicted Effect unknown
Transcript: ENSMUST00000205886
AA Change: E73V
Predicted Effect probably benign
Transcript: ENSMUST00000205911
Predicted Effect probably benign
Transcript: ENSMUST00000206619
Predicted Effect probably benign
Transcript: ENSMUST00000206626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206813
Meta Mutation Damage Score 0.1195 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency 98% (120/123)
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik C A 8: 87,568,493 Y86* probably null Het
Aadac A G 3: 60,039,697 E272G probably damaging Het
Abcc8 A T 7: 46,166,902 D271E probably benign Het
Acan T C 7: 79,099,035 F1185L probably benign Het
Adam1a A T 5: 121,519,620 C537S probably damaging Het
Ago2 A G 15: 73,123,965 V395A probably benign Het
Alox15 A G 11: 70,350,752 V101A probably damaging Het
Ankra2 T C 13: 98,271,124 I194T probably damaging Het
Apobec4 C A 1: 152,756,230 P3H probably damaging Het
Arid3b G T 9: 57,796,677 Y329* probably null Het
Atm A T 9: 53,468,012 S1993T probably benign Het
Bpgm T G 6: 34,487,734 S129A probably benign Het
Brat1 A G 5: 140,718,509 D839G possibly damaging Het
Ccdc15 A T 9: 37,342,570 S128T probably benign Het
Cd300lg A T 11: 102,046,206 probably benign Het
Cdc34b C A 11: 94,742,477 Q168K probably damaging Het
Celsr2 A T 3: 108,401,310 V1767E probably benign Het
Cep350 T C 1: 155,953,651 D169G probably benign Het
Col7a1 A T 9: 108,969,565 D1762V possibly damaging Het
Coro7 A G 16: 4,630,434 L724P probably damaging Het
Crb1 T A 1: 139,237,012 I1125F probably damaging Het
Ctif T A 18: 75,519,941 D415V probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dhrs2 A G 14: 55,240,841 D237G probably benign Het
Dhx9 T C 1: 153,465,753 Q582R probably damaging Het
Dnajc1 C T 2: 18,219,713 R443Q probably damaging Het
Dnm2 C T 9: 21,505,681 R837W possibly damaging Het
Dpf2 C A 19: 5,906,615 Q70H probably damaging Het
Dqx1 T A 6: 83,066,107 D608E probably damaging Het
Dync2h1 T A 9: 7,049,166 T3245S probably benign Het
Ect2l A G 10: 18,200,033 L35P probably damaging Het
Efcab5 A T 11: 77,103,306 L1285Q probably damaging Het
Eif4g1 G C 16: 20,681,867 R697P probably damaging Het
Entpd3 A G 9: 120,558,419 I227M probably damaging Het
Epn1 T A 7: 5,089,998 V103E probably damaging Het
Esrra T C 19: 6,912,010 D337G probably benign Het
Fam129c T C 8: 71,603,769 M371T possibly damaging Het
Fam83e A T 7: 45,728,769 K406* probably null Het
Fam83e A T 7: 45,728,770 K406M possibly damaging Het
Fat2 A G 11: 55,311,558 I230T probably damaging Het
Fbxl16 A G 17: 25,816,446 I6V probably benign Het
Fgf23 T C 6: 127,073,193 I55T probably damaging Het
Fibcd1 T A 2: 31,821,549 D288V probably damaging Het
Flnb T C 14: 7,892,113 I594T probably damaging Het
Gabbr2 T C 4: 46,739,823 E449G probably benign Het
Gbf1 T G 19: 46,272,037 S1130A possibly damaging Het
Gipc3 T C 10: 81,341,265 E157G probably damaging Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm6625 A C 8: 89,146,834 noncoding transcript Het
Gpx4 A G 10: 80,056,036 probably benign Het
Grb10 A G 11: 11,946,029 F264L possibly damaging Het
Grik3 T C 4: 125,694,138 Y684H probably damaging Het
Gstp1 C T 19: 4,036,795 probably benign Het
Haus8 G A 8: 71,256,123 probably benign Het
Hip1 G A 5: 135,435,141 probably null Het
Hist3h2ba A T 11: 58,949,102 I55F possibly damaging Het
Hspbap1 T A 16: 35,818,764 probably null Het
Htr2b T A 1: 86,099,429 I452F possibly damaging Het
Hydin T A 8: 110,569,808 H3656Q probably benign Het
Klb T A 5: 65,348,837 D142E probably benign Het
Lamb3 A T 1: 193,334,616 T777S possibly damaging Het
Lins1 C A 7: 66,714,322 T650K probably damaging Het
Loxhd1 A G 18: 77,281,971 K5R possibly damaging Het
Lpp G A 16: 24,761,655 M40I probably damaging Het
Mia2 A T 12: 59,170,251 probably benign Het
Miip A C 4: 147,863,092 F204V probably damaging Het
Mmp21 T C 7: 133,677,153 R323G probably benign Het
Mta3 T A 17: 83,755,551 probably benign Het
Myh1 A G 11: 67,213,630 K1004R probably benign Het
Myh14 T A 7: 44,632,429 I810F probably damaging Het
Nbas A C 12: 13,413,597 D1295A probably damaging Het
Npr2 T G 4: 43,632,384 V67G probably benign Het
Oas1f C A 5: 120,855,429 Q235K probably damaging Het
Olfr109 T A 17: 37,467,047 S280R probably damaging Het
Olfr59 G T 11: 74,289,213 C189F probably damaging Het
Olfr60 T A 7: 140,345,987 M1L probably benign Het
Olfr629 T C 7: 103,741,174 N22S probably benign Het
Olfr857 C T 9: 19,713,090 H88Y probably benign Het
Pafah2 GCCCC GCCCCC 4: 134,425,541 probably null Het
Pde1b A G 15: 103,525,340 probably null Het
Pdilt T C 7: 119,489,384 T465A probably benign Het
Plxnd1 T C 6: 115,966,546 H1233R probably damaging Het
Ppm1b T A 17: 84,994,124 M144K probably benign Het
Prkdc T C 16: 15,808,058 L3316S probably benign Het
Prm2 T A 16: 10,791,591 probably benign Het
Prmt7 T C 8: 106,237,008 V240A probably benign Het
Prx C A 7: 27,518,888 A938E possibly damaging Het
Rbm7 A G 9: 48,490,894 V131A probably benign Het
Ric1 T A 19: 29,600,813 probably null Het
Rnf150 A T 8: 82,864,010 M1L possibly damaging Het
Rnf20 C T 4: 49,644,628 R298W probably damaging Het
Rp1 T A 1: 4,347,232 Y1219F possibly damaging Het
Scn7a A G 2: 66,684,013 probably null Het
Sdad1 A G 5: 92,292,651 probably null Het
Sept9 T C 11: 117,353,083 probably benign Het
Serinc3 T C 2: 163,645,489 probably benign Het
Shc3 C T 13: 51,461,388 G178R probably damaging Het
Slc4a10 A T 2: 62,316,606 K1090M probably damaging Het
Slco1a1 T C 6: 141,923,111 I376V probably benign Het
Slmap A T 14: 26,422,574 F719L probably benign Het
Smgc A G 15: 91,859,758 N573D possibly damaging Het
Spx G A 6: 142,414,079 probably null Het
Srrt C G 5: 137,296,945 E308Q probably damaging Het
Tas2r130 T A 6: 131,630,597 R78S probably benign Het
Tchhl1 A G 3: 93,471,101 R371G probably damaging Het
Teddm2 C T 1: 153,850,448 A174T probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Trim33 T C 3: 103,324,640 probably benign Het
Tspan31 A G 10: 127,069,458 V40A probably damaging Het
Uevld A G 7: 46,945,227 probably benign Het
Vcl G T 14: 21,008,995 A560S probably benign Het
Vmn2r24 T A 6: 123,816,224 C837S probably damaging Het
Vmn2r57 C T 7: 41,428,107 V212M probably damaging Het
Vps13c A G 9: 67,936,340 T1968A probably benign Het
Vtn A G 11: 78,500,567 R269G probably damaging Het
Wdcp G A 12: 4,850,245 V34I possibly damaging Het
Zc3h14 A G 12: 98,752,832 D152G possibly damaging Het
Zfp189 C T 4: 49,529,266 P123L probably benign Het
Zfp318 T C 17: 46,406,055 S1038P possibly damaging Het
Zfp873 A G 10: 82,060,572 D416G probably benign Het
Other mutations in Emsy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Emsy APN 7 98593455 missense probably benign 0.09
IGL01357:Emsy APN 7 98590870 nonsense probably null
IGL01620:Emsy APN 7 98626624 missense probably damaging 1.00
IGL01750:Emsy APN 7 98619301 missense probably damaging 0.99
IGL02032:Emsy APN 7 98590780 missense possibly damaging 0.94
IGL02388:Emsy APN 7 98641666 missense probably damaging 0.99
IGL03089:Emsy APN 7 98637266 nonsense probably null
IGL03272:Emsy APN 7 98593762 missense probably damaging 0.98
IGL03347:Emsy APN 7 98610685 missense probably damaging 0.99
IGL03400:Emsy APN 7 98602726 missense possibly damaging 0.94
IGL02980:Emsy UTSW 7 98619380 missense probably damaging 0.97
R0576:Emsy UTSW 7 98593776 missense probably damaging 0.99
R1102:Emsy UTSW 7 98602589 missense probably damaging 0.97
R1323:Emsy UTSW 7 98610657 splice site probably benign
R1438:Emsy UTSW 7 98621406 missense possibly damaging 0.88
R1439:Emsy UTSW 7 98600841 intron probably benign
R1452:Emsy UTSW 7 98600674 missense probably damaging 0.96
R1515:Emsy UTSW 7 98590856 missense probably damaging 1.00
R1535:Emsy UTSW 7 98593737 missense possibly damaging 0.94
R1791:Emsy UTSW 7 98647880 missense probably damaging 0.99
R1829:Emsy UTSW 7 98602729 missense possibly damaging 0.95
R1829:Emsy UTSW 7 98602730 missense possibly damaging 0.88
R1861:Emsy UTSW 7 98641615 missense probably damaging 1.00
R1929:Emsy UTSW 7 98626623 missense probably damaging 0.99
R1957:Emsy UTSW 7 98647820 missense probably damaging 1.00
R2221:Emsy UTSW 7 98590775 missense possibly damaging 0.83
R2223:Emsy UTSW 7 98590775 missense possibly damaging 0.83
R2271:Emsy UTSW 7 98626623 missense probably damaging 0.99
R4078:Emsy UTSW 7 98590725 missense probably damaging 0.99
R4707:Emsy UTSW 7 98597104 missense possibly damaging 0.94
R4783:Emsy UTSW 7 98646479 missense possibly damaging 0.74
R5453:Emsy UTSW 7 98600806 missense probably damaging 0.97
R5518:Emsy UTSW 7 98593611 missense possibly damaging 0.86
R5828:Emsy UTSW 7 98593492 missense probably benign
R5945:Emsy UTSW 7 98619383 missense probably damaging 0.97
R6153:Emsy UTSW 7 98610853 missense probably damaging 1.00
R6824:Emsy UTSW 7 98593407 missense probably benign 0.27
R7068:Emsy UTSW 7 98610761 missense probably benign 0.17
R7381:Emsy UTSW 7 98590803 missense probably damaging 0.98
R7417:Emsy UTSW 7 98615486 missense probably damaging 1.00
R7488:Emsy UTSW 7 98615555 missense possibly damaging 0.94
R7499:Emsy UTSW 7 98630331 missense possibly damaging 0.59
R7646:Emsy UTSW 7 98619353 missense probably damaging 1.00
R7682:Emsy UTSW 7 98590698 missense probably damaging 0.99
R7716:Emsy UTSW 7 98599766 missense unknown
R7789:Emsy UTSW 7 98621489 missense probably damaging 1.00
R7794:Emsy UTSW 7 98600724 missense probably benign 0.30
R7832:Emsy UTSW 7 98639853 missense probably damaging 1.00
R7974:Emsy UTSW 7 98630218 missense possibly damaging 0.73
R7996:Emsy UTSW 7 98593681 missense probably benign 0.00
R8070:Emsy UTSW 7 98626715 missense possibly damaging 0.73
R8221:Emsy UTSW 7 98647904 missense probably damaging 1.00
R8472:Emsy UTSW 7 98654830 start gained probably benign
R8841:Emsy UTSW 7 98615561 missense possibly damaging 0.95
R8998:Emsy UTSW 7 98619305 missense possibly damaging 0.63
R9063:Emsy UTSW 7 98646477 missense probably damaging 0.96
R9259:Emsy UTSW 7 98593550 missense probably benign
R9366:Emsy UTSW 7 98641653 missense probably benign 0.23
R9660:Emsy UTSW 7 98613078 missense possibly damaging 0.95
R9729:Emsy UTSW 7 98613049 missense probably benign 0.01
X0067:Emsy UTSW 7 98630240 missense possibly damaging 0.65
Z1088:Emsy UTSW 7 98600722 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGAAGTCCGCAAAGGTAGC -3'
(R):5'- ATTGTAGGCTGCTGTTACATAGGC -3'

Sequencing Primer
(F):5'- TGAAGTCCGCAAAGGTAGCACTAC -3'
(R):5'- GCTGTTACATAGGCTGTAGTCTATAC -3'
Posted On 2014-06-23