Incidental Mutation 'R1848:Dnm2'
ID207910
Institutional Source Beutler Lab
Gene Symbol Dnm2
Ensembl Gene ENSMUSG00000033335
Gene Namedynamin 2
Synonymsb2b2159Clo, Dyn2
MMRRC Submission 039873-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1848 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21424908-21507759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21505681 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 837 (R837W)
Ref Sequence ENSEMBL: ENSMUSP00000134243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034698] [ENSMUST00000072362] [ENSMUST00000091087] [ENSMUST00000115404] [ENSMUST00000165766] [ENSMUST00000172482] [ENSMUST00000173397] [ENSMUST00000214576] [ENSMUST00000214285]
Predicted Effect probably benign
Transcript: ENSMUST00000034698
SMART Domains Protein: ENSMUSP00000034698
Gene: ENSMUSG00000032180

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
EMP24_GP25L 33 220 1.78e-54 SMART
Predicted Effect unknown
Transcript: ENSMUST00000072362
AA Change: R837W
SMART Domains Protein: ENSMUSP00000072199
Gene: ENSMUSG00000033335
AA Change: R837W

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000091087
AA Change: R833W

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000088616
Gene: ENSMUSG00000033335
AA Change: R833W

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 516 623 8e-13 SMART
GED 644 735 2.57e-28 SMART
low complexity region 736 748 N/A INTRINSIC
low complexity region 773 795 N/A INTRINSIC
low complexity region 827 860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000115404
AA Change: R837W
SMART Domains Protein: ENSMUSP00000111063
Gene: ENSMUSG00000033335
AA Change: R837W

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000165766
AA Change: R837W
SMART Domains Protein: ENSMUSP00000128961
Gene: ENSMUSG00000033335
AA Change: R837W

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 858 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000172482
AA Change: R837W
SMART Domains Protein: ENSMUSP00000133564
Gene: ENSMUSG00000033335
AA Change: R837W

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173299
Predicted Effect possibly damaging
Transcript: ENSMUST00000173397
AA Change: R837W

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134243
Gene: ENSMUSG00000033335
AA Change: R837W

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 863 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000174050
AA Change: R783W
SMART Domains Protein: ENSMUSP00000134696
Gene: ENSMUSG00000033335
AA Change: R783W

DomainStartEndE-ValueType
DYNc 1 196 8.6e-138 SMART
low complexity region 249 264 N/A INTRINSIC
PH 467 574 8e-13 SMART
GED 595 686 2.57e-28 SMART
low complexity region 687 699 N/A INTRINSIC
low complexity region 724 746 N/A INTRINSIC
low complexity region 778 805 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174243
Predicted Effect probably benign
Transcript: ENSMUST00000213167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213316
Predicted Effect probably benign
Transcript: ENSMUST00000214576
Predicted Effect probably benign
Transcript: ENSMUST00000214285
Meta Mutation Damage Score 0.1401 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency 98% (120/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dynamins represent one of the subfamilies of GTP-binding proteins. These proteins share considerable sequence similarity over the N-terminal portion of the molecule, which contains the GTPase domain. Dynamins are associated with microtubules. They have been implicated in cell processes such as endocytosis and cell motility, and in alterations of the membrane that accompany certain activities such as bone resorption by osteoclasts. Dynamins bind many proteins that bind actin and other cytoskeletal proteins. Dynamins can also self-assemble, a process that stimulates GTPase activity. Five alternatively spliced transcripts encoding different proteins have been described. Additional alternatively spliced transcripts may exist, but their full-length nature has not been determined. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted allele die prior to E8-E12. Mice heterozygous for a knock-out allele exhibit muscle atrophy and weakness, intermyofibrillar disorganization, and centrally localized mitochondria and sarcoplasmic reticulum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik C A 8: 87,568,493 Y86* probably null Het
Aadac A G 3: 60,039,697 E272G probably damaging Het
Abcc8 A T 7: 46,166,902 D271E probably benign Het
Acan T C 7: 79,099,035 F1185L probably benign Het
Adam1a A T 5: 121,519,620 C537S probably damaging Het
Ago2 A G 15: 73,123,965 V395A probably benign Het
Alox15 A G 11: 70,350,752 V101A probably damaging Het
Ankra2 T C 13: 98,271,124 I194T probably damaging Het
Apobec4 C A 1: 152,756,230 P3H probably damaging Het
Arid3b G T 9: 57,796,677 Y329* probably null Het
Atm A T 9: 53,468,012 S1993T probably benign Het
Bpgm T G 6: 34,487,734 S129A probably benign Het
Brat1 A G 5: 140,718,509 D839G possibly damaging Het
Ccdc15 A T 9: 37,342,570 S128T probably benign Het
Cd300lg A T 11: 102,046,206 probably benign Het
Cdc34b C A 11: 94,742,477 Q168K probably damaging Het
Celsr2 A T 3: 108,401,310 V1767E probably benign Het
Cep350 T C 1: 155,953,651 D169G probably benign Het
Col7a1 A T 9: 108,969,565 D1762V possibly damaging Het
Coro7 A G 16: 4,630,434 L724P probably damaging Het
Crb1 T A 1: 139,237,012 I1125F probably damaging Het
Ctif T A 18: 75,519,941 D415V probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dhrs2 A G 14: 55,240,841 D237G probably benign Het
Dhx9 T C 1: 153,465,753 Q582R probably damaging Het
Dnajc1 C T 2: 18,219,713 R443Q probably damaging Het
Dpf2 C A 19: 5,906,615 Q70H probably damaging Het
Dqx1 T A 6: 83,066,107 D608E probably damaging Het
Dync2h1 T A 9: 7,049,166 T3245S probably benign Het
Ect2l A G 10: 18,200,033 L35P probably damaging Het
Efcab5 A T 11: 77,103,306 L1285Q probably damaging Het
Eif4g1 G C 16: 20,681,867 R697P probably damaging Het
Emsy T A 7: 98,600,821 E753V probably damaging Het
Entpd3 A G 9: 120,558,419 I227M probably damaging Het
Epn1 T A 7: 5,089,998 V103E probably damaging Het
Esrra T C 19: 6,912,010 D337G probably benign Het
Fam129c T C 8: 71,603,769 M371T possibly damaging Het
Fam83e A T 7: 45,728,770 K406M possibly damaging Het
Fam83e A T 7: 45,728,769 K406* probably null Het
Fat2 A G 11: 55,311,558 I230T probably damaging Het
Fbxl16 A G 17: 25,816,446 I6V probably benign Het
Fgf23 T C 6: 127,073,193 I55T probably damaging Het
Fibcd1 T A 2: 31,821,549 D288V probably damaging Het
Flnb T C 14: 7,892,113 I594T probably damaging Het
Gabbr2 T C 4: 46,739,823 E449G probably benign Het
Gbf1 T G 19: 46,272,037 S1130A possibly damaging Het
Gipc3 T C 10: 81,341,265 E157G probably damaging Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm6625 A C 8: 89,146,834 noncoding transcript Het
Gpx4 A G 10: 80,056,036 probably benign Het
Grb10 A G 11: 11,946,029 F264L possibly damaging Het
Grik3 T C 4: 125,694,138 Y684H probably damaging Het
Gstp1 C T 19: 4,036,795 probably benign Het
Haus8 G A 8: 71,256,123 probably benign Het
Hip1 G A 5: 135,435,141 probably null Het
Hist3h2ba A T 11: 58,949,102 I55F possibly damaging Het
Hspbap1 T A 16: 35,818,764 probably null Het
Htr2b T A 1: 86,099,429 I452F possibly damaging Het
Hydin T A 8: 110,569,808 H3656Q probably benign Het
Klb T A 5: 65,348,837 D142E probably benign Het
Lamb3 A T 1: 193,334,616 T777S possibly damaging Het
Lins1 C A 7: 66,714,322 T650K probably damaging Het
Loxhd1 A G 18: 77,281,971 K5R possibly damaging Het
Lpp G A 16: 24,761,655 M40I probably damaging Het
Mia2 A T 12: 59,170,251 probably benign Het
Miip A C 4: 147,863,092 F204V probably damaging Het
Mmp21 T C 7: 133,677,153 R323G probably benign Het
Mta3 T A 17: 83,755,551 probably benign Het
Myh1 A G 11: 67,213,630 K1004R probably benign Het
Myh14 T A 7: 44,632,429 I810F probably damaging Het
Nbas A C 12: 13,413,597 D1295A probably damaging Het
Npr2 T G 4: 43,632,384 V67G probably benign Het
Oas1f C A 5: 120,855,429 Q235K probably damaging Het
Olfr109 T A 17: 37,467,047 S280R probably damaging Het
Olfr59 G T 11: 74,289,213 C189F probably damaging Het
Olfr60 T A 7: 140,345,987 M1L probably benign Het
Olfr629 T C 7: 103,741,174 N22S probably benign Het
Olfr857 C T 9: 19,713,090 H88Y probably benign Het
Pafah2 GCCCC GCCCCC 4: 134,425,541 probably null Het
Pde1b A G 15: 103,525,340 probably null Het
Pdilt T C 7: 119,489,384 T465A probably benign Het
Plxnd1 T C 6: 115,966,546 H1233R probably damaging Het
Ppm1b T A 17: 84,994,124 M144K probably benign Het
Prkdc T C 16: 15,808,058 L3316S probably benign Het
Prm2 T A 16: 10,791,591 probably benign Het
Prmt7 T C 8: 106,237,008 V240A probably benign Het
Prx C A 7: 27,518,888 A938E possibly damaging Het
Rbm7 A G 9: 48,490,894 V131A probably benign Het
Ric1 T A 19: 29,600,813 probably null Het
Rnf150 A T 8: 82,864,010 M1L possibly damaging Het
Rnf20 C T 4: 49,644,628 R298W probably damaging Het
Rp1 T A 1: 4,347,232 Y1219F possibly damaging Het
Scn7a A G 2: 66,684,013 probably null Het
Sdad1 A G 5: 92,292,651 probably null Het
Sept9 T C 11: 117,353,083 probably benign Het
Serinc3 T C 2: 163,645,489 probably benign Het
Shc3 C T 13: 51,461,388 G178R probably damaging Het
Slc4a10 A T 2: 62,316,606 K1090M probably damaging Het
Slco1a1 T C 6: 141,923,111 I376V probably benign Het
Slmap A T 14: 26,422,574 F719L probably benign Het
Smgc A G 15: 91,859,758 N573D possibly damaging Het
Spx G A 6: 142,414,079 probably null Het
Srrt C G 5: 137,296,945 E308Q probably damaging Het
Tas2r130 T A 6: 131,630,597 R78S probably benign Het
Tchhl1 A G 3: 93,471,101 R371G probably damaging Het
Teddm2 C T 1: 153,850,448 A174T probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Trim33 T C 3: 103,324,640 probably benign Het
Tspan31 A G 10: 127,069,458 V40A probably damaging Het
Uevld A G 7: 46,945,227 probably benign Het
Vcl G T 14: 21,008,995 A560S probably benign Het
Vmn2r24 T A 6: 123,816,224 C837S probably damaging Het
Vmn2r57 C T 7: 41,428,107 V212M probably damaging Het
Vps13c A G 9: 67,936,340 T1968A probably benign Het
Vtn A G 11: 78,500,567 R269G probably damaging Het
Wdcp G A 12: 4,850,245 V34I possibly damaging Het
Zc3h14 A G 12: 98,752,832 D152G possibly damaging Het
Zfp189 C T 4: 49,529,266 P123L probably benign Het
Zfp318 T C 17: 46,406,055 S1038P possibly damaging Het
Zfp873 A G 10: 82,060,572 D416G probably benign Het
Other mutations in Dnm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01446:Dnm2 APN 9 21481376 missense probably damaging 1.00
IGL01757:Dnm2 APN 9 21465619 missense probably damaging 1.00
IGL02142:Dnm2 APN 9 21500353 missense probably damaging 1.00
IGL02195:Dnm2 APN 9 21425249 missense probably damaging 1.00
IGL02472:Dnm2 APN 9 21485708 missense possibly damaging 0.55
IGL03161:Dnm2 APN 9 21485724 splice site probably benign
IGL03392:Dnm2 APN 9 21474611 missense probably damaging 1.00
R0302:Dnm2 UTSW 9 21500343 missense probably benign 0.27
R0743:Dnm2 UTSW 9 21500265 missense probably damaging 1.00
R0945:Dnm2 UTSW 9 21505660 missense probably damaging 0.97
R1629:Dnm2 UTSW 9 21504458 missense probably damaging 1.00
R1678:Dnm2 UTSW 9 21467532 missense possibly damaging 0.89
R2084:Dnm2 UTSW 9 21500371 critical splice donor site probably null
R2214:Dnm2 UTSW 9 21485723 critical splice donor site probably null
R2346:Dnm2 UTSW 9 21467556 missense probably damaging 1.00
R3711:Dnm2 UTSW 9 21506373 unclassified probably benign
R3796:Dnm2 UTSW 9 21505487 missense probably benign
R4017:Dnm2 UTSW 9 21494604 missense probably damaging 1.00
R4432:Dnm2 UTSW 9 21491304 intron probably benign
R4583:Dnm2 UTSW 9 21504446 missense probably damaging 1.00
R4604:Dnm2 UTSW 9 21504664 critical splice donor site probably null
R4735:Dnm2 UTSW 9 21474587 missense probably damaging 0.99
R4803:Dnm2 UTSW 9 21474629 missense probably damaging 1.00
R4832:Dnm2 UTSW 9 21474679 splice site probably null
R4836:Dnm2 UTSW 9 21491330 intron probably benign
R4937:Dnm2 UTSW 9 21481337 missense probably benign 0.00
R4948:Dnm2 UTSW 9 21504533 missense possibly damaging 0.90
R5059:Dnm2 UTSW 9 21504578 missense probably damaging 1.00
R5291:Dnm2 UTSW 9 21478907 missense probably damaging 1.00
R5538:Dnm2 UTSW 9 21505627 missense probably benign 0.05
R5613:Dnm2 UTSW 9 21472667 missense probably damaging 1.00
R5805:Dnm2 UTSW 9 21467669 missense probably damaging 0.97
R6253:Dnm2 UTSW 9 21500275 missense probably damaging 1.00
R6586:Dnm2 UTSW 9 21505646 missense probably benign 0.32
R6826:Dnm2 UTSW 9 21504471 nonsense probably null
R6855:Dnm2 UTSW 9 21476585 missense probably damaging 1.00
R7121:Dnm2 UTSW 9 21474566 missense probably benign 0.31
R7307:Dnm2 UTSW 9 21485687 missense probably damaging 1.00
R7318:Dnm2 UTSW 9 21505567 missense possibly damaging 0.46
R7467:Dnm2 UTSW 9 21481376 missense probably damaging 1.00
R7619:Dnm2 UTSW 9 21505634 missense probably benign 0.00
R7673:Dnm2 UTSW 9 21481421 critical splice donor site probably null
R8474:Dnm2 UTSW 9 21465720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATATCCTTCCTCCAGATTACAGC -3'
(R):5'- AGGGCTCAATGTCTCAGGAC -3'

Sequencing Primer
(F):5'- ACCTGTGTCCAGTGTGCAC -3'
(R):5'- TGTCTCAGGACACAAGCAG -3'
Posted On2014-06-23