Incidental Mutation 'R1848:Dnm2'
ID 207910
Institutional Source Beutler Lab
Gene Symbol Dnm2
Ensembl Gene ENSMUSG00000033335
Gene Name dynamin 2
Synonyms b2b2159Clo, Dyn2
MMRRC Submission 039873-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1848 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 21336204-21419055 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 21416977 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 837 (R837W)
Ref Sequence ENSEMBL: ENSMUSP00000134243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034698] [ENSMUST00000072362] [ENSMUST00000091087] [ENSMUST00000115404] [ENSMUST00000165766] [ENSMUST00000172482] [ENSMUST00000173397] [ENSMUST00000214576] [ENSMUST00000214285]
AlphaFold P39054
Predicted Effect probably benign
Transcript: ENSMUST00000034698
SMART Domains Protein: ENSMUSP00000034698
Gene: ENSMUSG00000032180

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
EMP24_GP25L 33 220 1.78e-54 SMART
Predicted Effect unknown
Transcript: ENSMUST00000072362
AA Change: R837W
SMART Domains Protein: ENSMUSP00000072199
Gene: ENSMUSG00000033335
AA Change: R837W

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000091087
AA Change: R833W

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000088616
Gene: ENSMUSG00000033335
AA Change: R833W

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 516 623 8e-13 SMART
GED 644 735 2.57e-28 SMART
low complexity region 736 748 N/A INTRINSIC
low complexity region 773 795 N/A INTRINSIC
low complexity region 827 860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000115404
AA Change: R837W
SMART Domains Protein: ENSMUSP00000111063
Gene: ENSMUSG00000033335
AA Change: R837W

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000165766
AA Change: R837W
SMART Domains Protein: ENSMUSP00000128961
Gene: ENSMUSG00000033335
AA Change: R837W

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 858 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000172482
AA Change: R837W
SMART Domains Protein: ENSMUSP00000133564
Gene: ENSMUSG00000033335
AA Change: R837W

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173299
Predicted Effect possibly damaging
Transcript: ENSMUST00000173397
AA Change: R837W

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134243
Gene: ENSMUSG00000033335
AA Change: R837W

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 863 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174243
Predicted Effect
SMART Domains Protein: ENSMUSP00000134696
Gene: ENSMUSG00000033335
AA Change: R783W

DomainStartEndE-ValueType
DYNc 1 196 8.6e-138 SMART
low complexity region 249 264 N/A INTRINSIC
PH 467 574 8e-13 SMART
GED 595 686 2.57e-28 SMART
low complexity region 687 699 N/A INTRINSIC
low complexity region 724 746 N/A INTRINSIC
low complexity region 778 805 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213316
Predicted Effect probably benign
Transcript: ENSMUST00000214576
Predicted Effect probably benign
Transcript: ENSMUST00000213167
Predicted Effect probably benign
Transcript: ENSMUST00000214285
Meta Mutation Damage Score 0.1401 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency 98% (120/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dynamins represent one of the subfamilies of GTP-binding proteins. These proteins share considerable sequence similarity over the N-terminal portion of the molecule, which contains the GTPase domain. Dynamins are associated with microtubules. They have been implicated in cell processes such as endocytosis and cell motility, and in alterations of the membrane that accompany certain activities such as bone resorption by osteoclasts. Dynamins bind many proteins that bind actin and other cytoskeletal proteins. Dynamins can also self-assemble, a process that stimulates GTPase activity. Five alternatively spliced transcripts encoding different proteins have been described. Additional alternatively spliced transcripts may exist, but their full-length nature has not been determined. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted allele die prior to E8-E12. Mice heterozygous for a knock-out allele exhibit muscle atrophy and weakness, intermyofibrillar disorganization, and centrally localized mitochondria and sarcoplasmic reticulum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik C A 8: 88,295,121 (GRCm39) Y86* probably null Het
Aadac A G 3: 59,947,118 (GRCm39) E272G probably damaging Het
Abcc8 A T 7: 45,816,326 (GRCm39) D271E probably benign Het
Acan T C 7: 78,748,783 (GRCm39) F1185L probably benign Het
Adam1a A T 5: 121,657,683 (GRCm39) C537S probably damaging Het
Ago2 A G 15: 72,995,814 (GRCm39) V395A probably benign Het
Alox15 A G 11: 70,241,578 (GRCm39) V101A probably damaging Het
Ankra2 T C 13: 98,407,632 (GRCm39) I194T probably damaging Het
Apobec4 C A 1: 152,631,981 (GRCm39) P3H probably damaging Het
Arid3b G T 9: 57,703,960 (GRCm39) Y329* probably null Het
Atm A T 9: 53,379,312 (GRCm39) S1993T probably benign Het
Bpgm T G 6: 34,464,669 (GRCm39) S129A probably benign Het
Brat1 A G 5: 140,704,264 (GRCm39) D839G possibly damaging Het
Ccdc15 A T 9: 37,253,866 (GRCm39) S128T probably benign Het
Cd300lg A T 11: 101,937,032 (GRCm39) probably benign Het
Cdc34b C A 11: 94,633,303 (GRCm39) Q168K probably damaging Het
Celsr2 A T 3: 108,308,626 (GRCm39) V1767E probably benign Het
Cep350 T C 1: 155,829,397 (GRCm39) D169G probably benign Het
Col7a1 A T 9: 108,798,633 (GRCm39) D1762V possibly damaging Het
Coro7 A G 16: 4,448,298 (GRCm39) L724P probably damaging Het
Crb1 T A 1: 139,164,750 (GRCm39) I1125F probably damaging Het
Ctif T A 18: 75,653,012 (GRCm39) D415V probably damaging Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dhrs2 A G 14: 55,478,298 (GRCm39) D237G probably benign Het
Dhx9 T C 1: 153,341,499 (GRCm39) Q582R probably damaging Het
Dnajc1 C T 2: 18,224,524 (GRCm39) R443Q probably damaging Het
Dpf2 C A 19: 5,956,643 (GRCm39) Q70H probably damaging Het
Dqx1 T A 6: 83,043,088 (GRCm39) D608E probably damaging Het
Dync2h1 T A 9: 7,049,166 (GRCm39) T3245S probably benign Het
Ect2l A G 10: 18,075,781 (GRCm39) L35P probably damaging Het
Efcab5 A T 11: 76,994,132 (GRCm39) L1285Q probably damaging Het
Eif4g1 G C 16: 20,500,617 (GRCm39) R697P probably damaging Het
Emsy T A 7: 98,250,028 (GRCm39) E753V probably damaging Het
Entpd3 A G 9: 120,387,485 (GRCm39) I227M probably damaging Het
Epn1 T A 7: 5,092,997 (GRCm39) V103E probably damaging Het
Esrra T C 19: 6,889,378 (GRCm39) D337G probably benign Het
Fam83e A T 7: 45,378,193 (GRCm39) K406* probably null Het
Fam83e A T 7: 45,378,194 (GRCm39) K406M possibly damaging Het
Fat2 A G 11: 55,202,384 (GRCm39) I230T probably damaging Het
Fbxl16 A G 17: 26,035,420 (GRCm39) I6V probably benign Het
Fgf23 T C 6: 127,050,156 (GRCm39) I55T probably damaging Het
Fibcd1 T A 2: 31,711,561 (GRCm39) D288V probably damaging Het
Flnb T C 14: 7,892,113 (GRCm38) I594T probably damaging Het
Gabbr2 T C 4: 46,739,823 (GRCm39) E449G probably benign Het
Gbf1 T G 19: 46,260,476 (GRCm39) S1130A possibly damaging Het
Gipc3 T C 10: 81,177,099 (GRCm39) E157G probably damaging Het
Glra3 G T 8: 56,393,942 (GRCm39) A18S probably benign Het
Gm6625 A C 8: 89,873,462 (GRCm39) noncoding transcript Het
Gpx4 A G 10: 79,891,870 (GRCm39) probably benign Het
Grb10 A G 11: 11,896,029 (GRCm39) F264L possibly damaging Het
Grik3 T C 4: 125,587,931 (GRCm39) Y684H probably damaging Het
Gstp1 C T 19: 4,086,795 (GRCm39) probably benign Het
H2bc27 A T 11: 58,839,928 (GRCm39) I55F possibly damaging Het
Haus8 G A 8: 71,708,767 (GRCm39) probably benign Het
Hip1 G A 5: 135,463,995 (GRCm39) probably null Het
Hspbap1 T A 16: 35,639,134 (GRCm39) probably null Het
Htr2b T A 1: 86,027,151 (GRCm39) I452F possibly damaging Het
Hydin T A 8: 111,296,440 (GRCm39) H3656Q probably benign Het
Klb T A 5: 65,506,180 (GRCm39) D142E probably benign Het
Lamb3 A T 1: 193,016,924 (GRCm39) T777S possibly damaging Het
Lins1 C A 7: 66,364,070 (GRCm39) T650K probably damaging Het
Loxhd1 A G 18: 77,369,667 (GRCm39) K5R possibly damaging Het
Lpp G A 16: 24,580,405 (GRCm39) M40I probably damaging Het
Mia2 A T 12: 59,217,037 (GRCm39) probably benign Het
Miip A C 4: 147,947,549 (GRCm39) F204V probably damaging Het
Mmp21 T C 7: 133,278,882 (GRCm39) R323G probably benign Het
Mta3 T A 17: 84,062,980 (GRCm39) probably benign Het
Myh1 A G 11: 67,104,456 (GRCm39) K1004R probably benign Het
Myh14 T A 7: 44,281,853 (GRCm39) I810F probably damaging Het
Nbas A C 12: 13,463,598 (GRCm39) D1295A probably damaging Het
Niban3 T C 8: 72,056,413 (GRCm39) M371T possibly damaging Het
Npr2 T G 4: 43,632,384 (GRCm39) V67G probably benign Het
Oas1f C A 5: 120,993,492 (GRCm39) Q235K probably damaging Het
Or12d17 T A 17: 37,777,938 (GRCm39) S280R probably damaging Het
Or13a27 T A 7: 139,925,900 (GRCm39) M1L probably benign Het
Or1p1 G T 11: 74,180,039 (GRCm39) C189F probably damaging Het
Or52ae9 T C 7: 103,390,381 (GRCm39) N22S probably benign Het
Or7e166 C T 9: 19,624,386 (GRCm39) H88Y probably benign Het
Pafah2 GCCCC GCCCCC 4: 134,152,852 (GRCm39) probably null Het
Pde1b A G 15: 103,433,767 (GRCm39) probably null Het
Pdilt T C 7: 119,088,607 (GRCm39) T465A probably benign Het
Plxnd1 T C 6: 115,943,507 (GRCm39) H1233R probably damaging Het
Ppm1b T A 17: 85,301,552 (GRCm39) M144K probably benign Het
Prkdc T C 16: 15,625,922 (GRCm39) L3316S probably benign Het
Prm2 T A 16: 10,609,455 (GRCm39) probably benign Het
Prmt7 T C 8: 106,963,640 (GRCm39) V240A probably benign Het
Prx C A 7: 27,218,313 (GRCm39) A938E possibly damaging Het
Rbm7 A G 9: 48,402,194 (GRCm39) V131A probably benign Het
Ric1 T A 19: 29,578,213 (GRCm39) probably null Het
Rnf150 A T 8: 83,590,639 (GRCm39) M1L possibly damaging Het
Rnf20 C T 4: 49,644,628 (GRCm39) R298W probably damaging Het
Rp1 T A 1: 4,417,455 (GRCm39) Y1219F possibly damaging Het
Scn7a A G 2: 66,514,357 (GRCm39) probably null Het
Sdad1 A G 5: 92,440,510 (GRCm39) probably null Het
Septin9 T C 11: 117,243,909 (GRCm39) probably benign Het
Serinc3 T C 2: 163,487,409 (GRCm39) probably benign Het
Shc3 C T 13: 51,615,424 (GRCm39) G178R probably damaging Het
Slc4a10 A T 2: 62,146,950 (GRCm39) K1090M probably damaging Het
Slco1a1 T C 6: 141,868,837 (GRCm39) I376V probably benign Het
Slmap A T 14: 26,143,729 (GRCm39) F719L probably benign Het
Smgc A G 15: 91,743,956 (GRCm39) N573D possibly damaging Het
Spx G A 6: 142,359,805 (GRCm39) probably null Het
Srrt C G 5: 137,295,207 (GRCm39) E308Q probably damaging Het
Tas2r130 T A 6: 131,607,560 (GRCm39) R78S probably benign Het
Tchhl1 A G 3: 93,378,408 (GRCm39) R371G probably damaging Het
Teddm2 C T 1: 153,726,194 (GRCm39) A174T probably benign Het
Tktl2 G A 8: 66,964,999 (GRCm39) V186M probably damaging Het
Trim33 T C 3: 103,231,956 (GRCm39) probably benign Het
Tspan31 A G 10: 126,905,327 (GRCm39) V40A probably damaging Het
Uevld A G 7: 46,594,975 (GRCm39) probably benign Het
Vcl G T 14: 21,059,063 (GRCm39) A560S probably benign Het
Vmn2r24 T A 6: 123,793,183 (GRCm39) C837S probably damaging Het
Vmn2r57 C T 7: 41,077,531 (GRCm39) V212M probably damaging Het
Vps13c A G 9: 67,843,622 (GRCm39) T1968A probably benign Het
Vtn A G 11: 78,391,393 (GRCm39) R269G probably damaging Het
Wdcp G A 12: 4,900,245 (GRCm39) V34I possibly damaging Het
Zc3h14 A G 12: 98,719,091 (GRCm39) D152G possibly damaging Het
Zfp189 C T 4: 49,529,266 (GRCm39) P123L probably benign Het
Zfp318 T C 17: 46,716,981 (GRCm39) S1038P possibly damaging Het
Zfp873 A G 10: 81,896,406 (GRCm39) D416G probably benign Het
Other mutations in Dnm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01446:Dnm2 APN 9 21,392,672 (GRCm39) missense probably damaging 1.00
IGL01757:Dnm2 APN 9 21,376,915 (GRCm39) missense probably damaging 1.00
IGL02142:Dnm2 APN 9 21,411,649 (GRCm39) missense probably damaging 1.00
IGL02195:Dnm2 APN 9 21,336,545 (GRCm39) missense probably damaging 1.00
IGL02472:Dnm2 APN 9 21,397,004 (GRCm39) missense possibly damaging 0.55
IGL03161:Dnm2 APN 9 21,397,020 (GRCm39) splice site probably benign
IGL03392:Dnm2 APN 9 21,385,907 (GRCm39) missense probably damaging 1.00
R0302:Dnm2 UTSW 9 21,411,639 (GRCm39) missense probably benign 0.27
R0743:Dnm2 UTSW 9 21,411,561 (GRCm39) missense probably damaging 1.00
R0945:Dnm2 UTSW 9 21,416,956 (GRCm39) missense probably damaging 0.97
R1629:Dnm2 UTSW 9 21,415,754 (GRCm39) missense probably damaging 1.00
R1678:Dnm2 UTSW 9 21,378,828 (GRCm39) missense possibly damaging 0.89
R2084:Dnm2 UTSW 9 21,411,667 (GRCm39) critical splice donor site probably null
R2214:Dnm2 UTSW 9 21,397,019 (GRCm39) critical splice donor site probably null
R2346:Dnm2 UTSW 9 21,378,852 (GRCm39) missense probably damaging 1.00
R3711:Dnm2 UTSW 9 21,417,669 (GRCm39) unclassified probably benign
R3796:Dnm2 UTSW 9 21,416,783 (GRCm39) missense probably benign
R4017:Dnm2 UTSW 9 21,405,900 (GRCm39) missense probably damaging 1.00
R4432:Dnm2 UTSW 9 21,402,600 (GRCm39) intron probably benign
R4583:Dnm2 UTSW 9 21,415,742 (GRCm39) missense probably damaging 1.00
R4604:Dnm2 UTSW 9 21,415,960 (GRCm39) critical splice donor site probably null
R4735:Dnm2 UTSW 9 21,385,883 (GRCm39) missense probably damaging 0.99
R4803:Dnm2 UTSW 9 21,385,925 (GRCm39) missense probably damaging 1.00
R4832:Dnm2 UTSW 9 21,385,975 (GRCm39) splice site probably null
R4836:Dnm2 UTSW 9 21,402,626 (GRCm39) intron probably benign
R4937:Dnm2 UTSW 9 21,392,633 (GRCm39) missense probably benign 0.00
R4948:Dnm2 UTSW 9 21,415,829 (GRCm39) missense possibly damaging 0.90
R5059:Dnm2 UTSW 9 21,415,874 (GRCm39) missense probably damaging 1.00
R5291:Dnm2 UTSW 9 21,390,203 (GRCm39) missense probably damaging 1.00
R5538:Dnm2 UTSW 9 21,416,923 (GRCm39) missense probably benign 0.05
R5613:Dnm2 UTSW 9 21,383,963 (GRCm39) missense probably damaging 1.00
R5805:Dnm2 UTSW 9 21,378,965 (GRCm39) missense probably damaging 0.97
R6253:Dnm2 UTSW 9 21,411,571 (GRCm39) missense probably damaging 1.00
R6586:Dnm2 UTSW 9 21,416,942 (GRCm39) missense probably benign 0.32
R6826:Dnm2 UTSW 9 21,415,767 (GRCm39) nonsense probably null
R6855:Dnm2 UTSW 9 21,387,881 (GRCm39) missense probably damaging 1.00
R7121:Dnm2 UTSW 9 21,385,862 (GRCm39) missense probably benign 0.31
R7307:Dnm2 UTSW 9 21,396,983 (GRCm39) missense probably damaging 1.00
R7318:Dnm2 UTSW 9 21,416,863 (GRCm39) missense possibly damaging 0.46
R7467:Dnm2 UTSW 9 21,392,672 (GRCm39) missense probably damaging 1.00
R7619:Dnm2 UTSW 9 21,416,930 (GRCm39) missense probably benign 0.00
R7673:Dnm2 UTSW 9 21,392,717 (GRCm39) critical splice donor site probably null
R8474:Dnm2 UTSW 9 21,377,016 (GRCm39) missense probably damaging 1.00
R9275:Dnm2 UTSW 9 21,416,977 (GRCm39) missense possibly damaging 0.87
R9278:Dnm2 UTSW 9 21,416,977 (GRCm39) missense possibly damaging 0.87
R9383:Dnm2 UTSW 9 21,383,920 (GRCm39) missense probably damaging 1.00
R9610:Dnm2 UTSW 9 21,414,973 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATATCCTTCCTCCAGATTACAGC -3'
(R):5'- AGGGCTCAATGTCTCAGGAC -3'

Sequencing Primer
(F):5'- ACCTGTGTCCAGTGTGCAC -3'
(R):5'- TGTCTCAGGACACAAGCAG -3'
Posted On 2014-06-23