Incidental Mutation 'R1848:Atm'
ID207913
Institutional Source Beutler Lab
Gene Symbol Atm
Ensembl Gene ENSMUSG00000034218
Gene Nameataxia telangiectasia mutated
SynonymsC030026E19Rik
MMRRC Submission 039873-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.899) question?
Stock #R1848 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location53439149-53536740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53468012 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1993 (S1993T)
Ref Sequence ENSEMBL: ENSMUSP00000156344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118282] [ENSMUST00000232179]
Predicted Effect probably benign
Transcript: ENSMUST00000118282
AA Change: S1993T

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218
AA Change: S1993T

DomainStartEndE-ValueType
TAN 1 166 5.07e-68 SMART
low complexity region 431 445 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
SCOP:d1gw5a_ 1039 1568 2e-4 SMART
coiled coil region 1615 1644 N/A INTRINSIC
low complexity region 1650 1662 N/A INTRINSIC
Pfam:FAT 2102 2499 4.4e-50 PFAM
low complexity region 2587 2599 N/A INTRINSIC
PI3Kc 2723 3026 1.11e-117 SMART
FATC 3034 3066 3.71e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232179
AA Change: S1993T

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0761 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency 98% (120/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik C A 8: 87,568,493 Y86* probably null Het
Aadac A G 3: 60,039,697 E272G probably damaging Het
Abcc8 A T 7: 46,166,902 D271E probably benign Het
Acan T C 7: 79,099,035 F1185L probably benign Het
Adam1a A T 5: 121,519,620 C537S probably damaging Het
Ago2 A G 15: 73,123,965 V395A probably benign Het
Alox15 A G 11: 70,350,752 V101A probably damaging Het
Ankra2 T C 13: 98,271,124 I194T probably damaging Het
Apobec4 C A 1: 152,756,230 P3H probably damaging Het
Arid3b G T 9: 57,796,677 Y329* probably null Het
Bpgm T G 6: 34,487,734 S129A probably benign Het
Brat1 A G 5: 140,718,509 D839G possibly damaging Het
Ccdc15 A T 9: 37,342,570 S128T probably benign Het
Cd300lg A T 11: 102,046,206 probably benign Het
Cdc34b C A 11: 94,742,477 Q168K probably damaging Het
Celsr2 A T 3: 108,401,310 V1767E probably benign Het
Cep350 T C 1: 155,953,651 D169G probably benign Het
Col7a1 A T 9: 108,969,565 D1762V possibly damaging Het
Coro7 A G 16: 4,630,434 L724P probably damaging Het
Crb1 T A 1: 139,237,012 I1125F probably damaging Het
Ctif T A 18: 75,519,941 D415V probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dhrs2 A G 14: 55,240,841 D237G probably benign Het
Dhx9 T C 1: 153,465,753 Q582R probably damaging Het
Dnajc1 C T 2: 18,219,713 R443Q probably damaging Het
Dnm2 C T 9: 21,505,681 R837W possibly damaging Het
Dpf2 C A 19: 5,906,615 Q70H probably damaging Het
Dqx1 T A 6: 83,066,107 D608E probably damaging Het
Dync2h1 T A 9: 7,049,166 T3245S probably benign Het
Ect2l A G 10: 18,200,033 L35P probably damaging Het
Efcab5 A T 11: 77,103,306 L1285Q probably damaging Het
Eif4g1 G C 16: 20,681,867 R697P probably damaging Het
Emsy T A 7: 98,600,821 E753V probably damaging Het
Entpd3 A G 9: 120,558,419 I227M probably damaging Het
Epn1 T A 7: 5,089,998 V103E probably damaging Het
Esrra T C 19: 6,912,010 D337G probably benign Het
Fam129c T C 8: 71,603,769 M371T possibly damaging Het
Fam83e A T 7: 45,728,769 K406* probably null Het
Fam83e A T 7: 45,728,770 K406M possibly damaging Het
Fat2 A G 11: 55,311,558 I230T probably damaging Het
Fbxl16 A G 17: 25,816,446 I6V probably benign Het
Fgf23 T C 6: 127,073,193 I55T probably damaging Het
Fibcd1 T A 2: 31,821,549 D288V probably damaging Het
Flnb T C 14: 7,892,113 I594T probably damaging Het
Gabbr2 T C 4: 46,739,823 E449G probably benign Het
Gbf1 T G 19: 46,272,037 S1130A possibly damaging Het
Gipc3 T C 10: 81,341,265 E157G probably damaging Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm6625 A C 8: 89,146,834 noncoding transcript Het
Gpx4 A G 10: 80,056,036 probably benign Het
Grb10 A G 11: 11,946,029 F264L possibly damaging Het
Grik3 T C 4: 125,694,138 Y684H probably damaging Het
Gstp1 C T 19: 4,036,795 probably benign Het
Haus8 G A 8: 71,256,123 probably benign Het
Hip1 G A 5: 135,435,141 probably null Het
Hist3h2ba A T 11: 58,949,102 I55F possibly damaging Het
Hspbap1 T A 16: 35,818,764 probably null Het
Htr2b T A 1: 86,099,429 I452F possibly damaging Het
Hydin T A 8: 110,569,808 H3656Q probably benign Het
Klb T A 5: 65,348,837 D142E probably benign Het
Lamb3 A T 1: 193,334,616 T777S possibly damaging Het
Lins1 C A 7: 66,714,322 T650K probably damaging Het
Loxhd1 A G 18: 77,281,971 K5R possibly damaging Het
Lpp G A 16: 24,761,655 M40I probably damaging Het
Mia2 A T 12: 59,170,251 probably benign Het
Miip A C 4: 147,863,092 F204V probably damaging Het
Mmp21 T C 7: 133,677,153 R323G probably benign Het
Mta3 T A 17: 83,755,551 probably benign Het
Myh1 A G 11: 67,213,630 K1004R probably benign Het
Myh14 T A 7: 44,632,429 I810F probably damaging Het
Nbas A C 12: 13,413,597 D1295A probably damaging Het
Npr2 T G 4: 43,632,384 V67G probably benign Het
Oas1f C A 5: 120,855,429 Q235K probably damaging Het
Olfr109 T A 17: 37,467,047 S280R probably damaging Het
Olfr59 G T 11: 74,289,213 C189F probably damaging Het
Olfr60 T A 7: 140,345,987 M1L probably benign Het
Olfr629 T C 7: 103,741,174 N22S probably benign Het
Olfr857 C T 9: 19,713,090 H88Y probably benign Het
Pafah2 GCCCC GCCCCC 4: 134,425,541 probably null Het
Pde1b A G 15: 103,525,340 probably null Het
Pdilt T C 7: 119,489,384 T465A probably benign Het
Plxnd1 T C 6: 115,966,546 H1233R probably damaging Het
Ppm1b T A 17: 84,994,124 M144K probably benign Het
Prkdc T C 16: 15,808,058 L3316S probably benign Het
Prm2 T A 16: 10,791,591 probably benign Het
Prmt7 T C 8: 106,237,008 V240A probably benign Het
Prx C A 7: 27,518,888 A938E possibly damaging Het
Rbm7 A G 9: 48,490,894 V131A probably benign Het
Ric1 T A 19: 29,600,813 probably null Het
Rnf150 A T 8: 82,864,010 M1L possibly damaging Het
Rnf20 C T 4: 49,644,628 R298W probably damaging Het
Rp1 T A 1: 4,347,232 Y1219F possibly damaging Het
Scn7a A G 2: 66,684,013 probably null Het
Sdad1 A G 5: 92,292,651 probably null Het
Sept9 T C 11: 117,353,083 probably benign Het
Serinc3 T C 2: 163,645,489 probably benign Het
Shc3 C T 13: 51,461,388 G178R probably damaging Het
Slc4a10 A T 2: 62,316,606 K1090M probably damaging Het
Slco1a1 T C 6: 141,923,111 I376V probably benign Het
Slmap A T 14: 26,422,574 F719L probably benign Het
Smgc A G 15: 91,859,758 N573D possibly damaging Het
Spx G A 6: 142,414,079 probably null Het
Srrt C G 5: 137,296,945 E308Q probably damaging Het
Tas2r130 T A 6: 131,630,597 R78S probably benign Het
Tchhl1 A G 3: 93,471,101 R371G probably damaging Het
Teddm2 C T 1: 153,850,448 A174T probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Trim33 T C 3: 103,324,640 probably benign Het
Tspan31 A G 10: 127,069,458 V40A probably damaging Het
Uevld A G 7: 46,945,227 probably benign Het
Vcl G T 14: 21,008,995 A560S probably benign Het
Vmn2r24 T A 6: 123,816,224 C837S probably damaging Het
Vmn2r57 C T 7: 41,428,107 V212M probably damaging Het
Vps13c A G 9: 67,936,340 T1968A probably benign Het
Vtn A G 11: 78,500,567 R269G probably damaging Het
Wdcp G A 12: 4,850,245 V34I possibly damaging Het
Zc3h14 A G 12: 98,752,832 D152G possibly damaging Het
Zfp189 C T 4: 49,529,266 P123L probably benign Het
Zfp318 T C 17: 46,406,055 S1038P possibly damaging Het
Zfp873 A G 10: 82,060,572 D416G probably benign Het
Other mutations in Atm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Atm APN 9 53524443 missense probably damaging 1.00
IGL00466:Atm APN 9 53499112 splice site probably benign
IGL00567:Atm APN 9 53503116 nonsense probably null
IGL00702:Atm APN 9 53511831 missense probably benign 0.02
IGL00743:Atm APN 9 53513116 missense probably benign 0.00
IGL00771:Atm APN 9 53493054 missense probably benign 0.01
IGL00773:Atm APN 9 53522144 missense probably benign 0.00
IGL00819:Atm APN 9 53518531 missense probably damaging 1.00
IGL00864:Atm APN 9 53533933 missense probably damaging 0.99
IGL00985:Atm APN 9 53459816 missense probably damaging 0.98
IGL01109:Atm APN 9 53490293 missense probably damaging 1.00
IGL01120:Atm APN 9 53461122 critical splice acceptor site probably null
IGL01369:Atm APN 9 53515317 missense probably benign
IGL01374:Atm APN 9 53531724 missense possibly damaging 0.58
IGL01406:Atm APN 9 53439746 makesense probably null
IGL01409:Atm APN 9 53499171 missense probably benign 0.01
IGL01434:Atm APN 9 53507807 missense probably benign 0.04
IGL01486:Atm APN 9 53510213 missense probably benign
IGL01583:Atm APN 9 53484247 splice site probably benign
IGL01861:Atm APN 9 53494612 missense probably null 0.89
IGL01865:Atm APN 9 53461002 missense probably damaging 1.00
IGL02026:Atm APN 9 53442417 unclassified probably null
IGL02072:Atm APN 9 53459796 missense probably benign 0.01
IGL02075:Atm APN 9 53527237 missense probably damaging 1.00
IGL02127:Atm APN 9 53487983 missense probably damaging 1.00
IGL02175:Atm APN 9 53480665 missense probably damaging 0.99
IGL02246:Atm APN 9 53527185 missense probably benign 0.12
IGL02259:Atm APN 9 53518494 splice site probably benign
IGL02351:Atm APN 9 53522176 missense probably benign 0.04
IGL02358:Atm APN 9 53522176 missense probably benign 0.04
IGL02387:Atm APN 9 53479766 splice site probably null
IGL02417:Atm APN 9 53479695 missense probably benign 0.00
IGL02422:Atm APN 9 53500792 missense probably damaging 1.00
IGL02445:Atm APN 9 53454330 missense probably benign 0.00
IGL02492:Atm APN 9 53455859 missense probably damaging 0.99
IGL02513:Atm APN 9 53497262 splice site probably benign
IGL02633:Atm APN 9 53448153 missense probably damaging 1.00
IGL02634:Atm APN 9 53516563 missense probably benign 0.00
IGL02948:Atm APN 9 53453440 splice site probably benign
IGL02959:Atm APN 9 53471418 missense probably damaging 1.00
IGL02965:Atm APN 9 53453563 missense probably damaging 1.00
IGL03085:Atm APN 9 53484171 missense possibly damaging 0.89
antebellum UTSW 9 53518559 nonsense probably null
Civil UTSW 9 53492268 missense possibly damaging 0.78
Grant UTSW 9 53511917 nonsense probably null
mockingbird UTSW 9 53516467 nonsense probably null
mockingbird2 UTSW 9 53488587 missense probably damaging 1.00
osphere UTSW 9 53479673 missense probably damaging 0.99
shiloh UTSW 9 53465298 missense probably damaging 1.00
Strato UTSW 9 53503018 missense probably damaging 1.00
tropo UTSW 9 53531648 missense probably damaging 1.00
P0019:Atm UTSW 9 53465028 splice site probably benign
PIT4403001:Atm UTSW 9 53500982 missense probably benign
PIT4687001:Atm UTSW 9 53486812 critical splice donor site probably null
R0004:Atm UTSW 9 53453528 splice site probably benign
R0035:Atm UTSW 9 53513180 missense probably benign 0.01
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0201:Atm UTSW 9 53454279 splice site probably benign
R0304:Atm UTSW 9 53516344 missense probably benign 0.34
R0308:Atm UTSW 9 53454473 intron probably null
R0362:Atm UTSW 9 53458838 missense possibly damaging 0.90
R0470:Atm UTSW 9 53460966 missense probably damaging 1.00
R0513:Atm UTSW 9 53503948 missense probably benign 0.00
R0589:Atm UTSW 9 53490192 missense possibly damaging 0.51
R0617:Atm UTSW 9 53458941 nonsense probably null
R0630:Atm UTSW 9 53531622 splice site probably benign
R0652:Atm UTSW 9 53486014 missense probably damaging 0.98
R0698:Atm UTSW 9 53515239 missense probably damaging 1.00
R0737:Atm UTSW 9 53456566 missense probably damaging 1.00
R0885:Atm UTSW 9 53459823 missense probably benign
R0947:Atm UTSW 9 53504092 missense probably benign 0.01
R0948:Atm UTSW 9 53495958 missense probably benign
R1144:Atm UTSW 9 53511698 splice site probably benign
R1252:Atm UTSW 9 53455840 missense probably damaging 1.00
R1295:Atm UTSW 9 53456530 missense probably damaging 1.00
R1296:Atm UTSW 9 53456530 missense probably damaging 1.00
R1419:Atm UTSW 9 53457489 missense probably benign 0.00
R1477:Atm UTSW 9 53464273 missense probably benign 0.00
R1596:Atm UTSW 9 53453378 missense probably damaging 1.00
R1630:Atm UTSW 9 53479673 missense probably damaging 0.99
R1667:Atm UTSW 9 53500932 missense probably damaging 1.00
R1681:Atm UTSW 9 53522155 missense possibly damaging 0.94
R1703:Atm UTSW 9 53500700 missense probably benign
R1817:Atm UTSW 9 53492233 splice site probably benign
R1840:Atm UTSW 9 53456530 missense probably damaging 1.00
R1906:Atm UTSW 9 53506568 missense probably damaging 1.00
R1958:Atm UTSW 9 53471418 missense probably damaging 1.00
R2108:Atm UTSW 9 53443997 missense probably damaging 1.00
R2116:Atm UTSW 9 53500969 missense probably benign 0.36
R2134:Atm UTSW 9 53467964 critical splice donor site probably null
R2137:Atm UTSW 9 53453375 missense probably damaging 1.00
R2291:Atm UTSW 9 53490909 splice site probably null
R2348:Atm UTSW 9 53492268 missense possibly damaging 0.78
R2483:Atm UTSW 9 53510266 missense probably damaging 1.00
R2567:Atm UTSW 9 53457470 missense possibly damaging 0.72
R2897:Atm UTSW 9 53507805 missense probably damaging 0.99
R2939:Atm UTSW 9 53494711 missense probably damaging 1.00
R3008:Atm UTSW 9 53480750 missense probably benign 0.00
R3236:Atm UTSW 9 53479748 missense probably benign 0.15
R3847:Atm UTSW 9 53503075 missense possibly damaging 0.94
R3889:Atm UTSW 9 53506636 splice site probably benign
R3919:Atm UTSW 9 53492278 missense probably benign 0.00
R4125:Atm UTSW 9 53450621 missense probably damaging 1.00
R4222:Atm UTSW 9 53480669 missense probably benign
R4395:Atm UTSW 9 53465227 missense probably benign 0.09
R4466:Atm UTSW 9 53448169 nonsense probably null
R4502:Atm UTSW 9 53495946 missense possibly damaging 0.92
R4514:Atm UTSW 9 53493039 missense probably damaging 0.99
R4528:Atm UTSW 9 53500759 missense probably benign 0.39
R4593:Atm UTSW 9 53453594 missense possibly damaging 0.55
R4627:Atm UTSW 9 53456506 missense possibly damaging 0.79
R4634:Atm UTSW 9 53531733 missense probably benign 0.01
R4665:Atm UTSW 9 53464229 missense probably benign 0.00
R4672:Atm UTSW 9 53522201 missense probably damaging 0.99
R4741:Atm UTSW 9 53453607 missense probably benign 0.10
R4808:Atm UTSW 9 53445495 missense probably damaging 0.99
R4959:Atm UTSW 9 53515301 missense probably benign
R4996:Atm UTSW 9 53524507 missense probably benign 0.09
R5030:Atm UTSW 9 53520109 nonsense probably null
R5214:Atm UTSW 9 53491027 missense probably benign 0.09
R5260:Atm UTSW 9 53506611 missense probably damaging 0.99
R5311:Atm UTSW 9 53518623 missense probably benign 0.00
R5394:Atm UTSW 9 53507777 critical splice donor site probably null
R5400:Atm UTSW 9 53503018 missense probably damaging 1.00
R5436:Atm UTSW 9 53459804 missense probably benign 0.00
R5441:Atm UTSW 9 53516467 nonsense probably null
R5569:Atm UTSW 9 53516450 nonsense probably null
R5856:Atm UTSW 9 53495955 missense possibly damaging 0.64
R5891:Atm UTSW 9 53497159 missense probably benign
R5910:Atm UTSW 9 53448080 missense probably damaging 0.96
R6054:Atm UTSW 9 53459873 missense probably damaging 1.00
R6062:Atm UTSW 9 53488587 missense probably damaging 1.00
R6092:Atm UTSW 9 53524414 missense probably damaging 1.00
R6127:Atm UTSW 9 53524509 missense probably damaging 1.00
R6160:Atm UTSW 9 53490959 missense probably benign 0.04
R6267:Atm UTSW 9 53444000 missense probably damaging 1.00
R6273:Atm UTSW 9 53487922 missense probably benign 0.09
R6284:Atm UTSW 9 53445376 splice site probably null
R6478:Atm UTSW 9 53490254 missense probably damaging 1.00
R6547:Atm UTSW 9 53440157 missense probably damaging 1.00
R6549:Atm UTSW 9 53493177 missense probably benign 0.00
R6704:Atm UTSW 9 53458853 missense probably benign 0.02
R6715:Atm UTSW 9 53531648 missense probably damaging 1.00
R6737:Atm UTSW 9 53486051 missense probably benign 0.30
R6759:Atm UTSW 9 53518559 nonsense probably null
R6766:Atm UTSW 9 53490282 missense probably damaging 0.99
R6813:Atm UTSW 9 53497235 missense probably benign 0.00
R6852:Atm UTSW 9 53482430 missense possibly damaging 0.93
R7064:Atm UTSW 9 53507881 missense probably benign 0.02
R7208:Atm UTSW 9 53512008 intron probably null
R7211:Atm UTSW 9 53488560 missense probably benign 0.01
R7220:Atm UTSW 9 53511917 nonsense probably null
R7336:Atm UTSW 9 53462503 missense possibly damaging 0.47
R7363:Atm UTSW 9 53465298 missense probably damaging 1.00
R7378:Atm UTSW 9 53453437 critical splice acceptor site probably null
R7472:Atm UTSW 9 53448125 missense possibly damaging 0.81
R7487:Atm UTSW 9 53524354 missense probably benign
R7497:Atm UTSW 9 53511891 missense probably benign 0.00
R7584:Atm UTSW 9 53513127 missense probably damaging 0.99
R7624:Atm UTSW 9 53454768 missense probably damaging 0.99
R7653:Atm UTSW 9 53490302 nonsense probably null
R7660:Atm UTSW 9 53445507 missense probably benign 0.01
R7679:Atm UTSW 9 53442497 missense probably damaging 1.00
R7720:Atm UTSW 9 53522239 missense possibly damaging 0.54
X0067:Atm UTSW 9 53479694 missense probably benign 0.00
Z1088:Atm UTSW 9 53531687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAATCACTTCTCTAATCAGAGC -3'
(R):5'- AGGCCTGTCTTAGCATATAACTGC -3'

Sequencing Primer
(F):5'- TTGAACTCATGACCTCTGGAAGAGC -3'
(R):5'- ATGCCAGTTCTAAATGATATACTGTG -3'
Posted On2014-06-23