Mutagenetix > Incidental Mutation

Incidental Mutation 'R1848:Vps13c'

207915

Institutional Source

Beutler Lab

Gene Symbol

Vps13c

Ensembl Gene

ENSMUSG00000035284

Gene Name

vacuolar protein sorting 13C

Synonyms

C230055H22Rik

MMRRC Submission

039873-MU

Accession Numbers

Genbank: NM_177184; MGI: 2444207

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1848 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

67840396-67995638 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 67936340 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1968 (T1968A)

Ref Sequence

ENSEMBL: ENSMUSP00000077040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077879]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000077879
AA Change: T1968A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284
AA Change: T1968A

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	3	117	1.3e-39	PFAM
low complexity region	151	165	N/A	INTRINSIC
Pfam:VPS13	182	414	7.9e-70	PFAM
coiled coil region	422	443	N/A	INTRINSIC
low complexity region	479	490	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	611	832	7.8e-71	PFAM
low complexity region	867	885	N/A	INTRINSIC
low complexity region	1020	1036	N/A	INTRINSIC
low complexity region	1112	1123	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1172	1369	2.1e-14	PFAM
low complexity region	1552	1573	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1685	1883	2.8e-13	PFAM
Blast:INB	2128	2403	2e-48	BLAST
Pfam:SHR-BD	2759	3013	9.9e-32	PFAM
Pfam:VPS13_C	3317	3495	5.7e-65	PFAM
Pfam:ATG_C	3498	3588	7.9e-12	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.2%

Validation Efficiency

98% (120/123)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vacuolar protein sorting-associated 13 gene family. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]

Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock

Total: 120 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933402J07Rik	C	A	8: 87,568,493	Y86*	probably null	Het
Aadac	A	G	3: 60,039,697	E272G	probably damaging	Het
Abcc8	A	T	7: 46,166,902	D271E	probably benign	Het
Acan	T	C	7: 79,099,035	F1185L	probably benign	Het
Adam1a	A	T	5: 121,519,620	C537S	probably damaging	Het
Ago2	A	G	15: 73,123,965	V395A	probably benign	Het
Alox15	A	G	11: 70,350,752	V101A	probably damaging	Het
Ankra2	T	C	13: 98,271,124	I194T	probably damaging	Het
Apobec4	C	A	1: 152,756,230	P3H	probably damaging	Het
Arid3b	G	T	9: 57,796,677	Y329*	probably null	Het
Atm	A	T	9: 53,468,012	S1993T	probably benign	Het
Bpgm	T	G	6: 34,487,734	S129A	probably benign	Het
Brat1	A	G	5: 140,718,509	D839G	possibly damaging	Het
Ccdc15	A	T	9: 37,342,570	S128T	probably benign	Het
Cd300lg	A	T	11: 102,046,206		probably benign	Het
Cdc34b	C	A	11: 94,742,477	Q168K	probably damaging	Het
Celsr2	A	T	3: 108,401,310	V1767E	probably benign	Het
Cep350	T	C	1: 155,953,651	D169G	probably benign	Het
Col7a1	A	T	9: 108,969,565	D1762V	possibly damaging	Het
Coro7	A	G	16: 4,630,434	L724P	probably damaging	Het
Crb1	T	A	1: 139,237,012	I1125F	probably damaging	Het
Ctif	T	A	18: 75,519,941	D415V	probably damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dhrs2	A	G	14: 55,240,841	D237G	probably benign	Het
Dhx9	T	C	1: 153,465,753	Q582R	probably damaging	Het
Dnajc1	C	T	2: 18,219,713	R443Q	probably damaging	Het
Dnm2	C	T	9: 21,505,681	R837W	possibly damaging	Het
Dpf2	C	A	19: 5,906,615	Q70H	probably damaging	Het
Dqx1	T	A	6: 83,066,107	D608E	probably damaging	Het
Dync2h1	T	A	9: 7,049,166	T3245S	probably benign	Het
Ect2l	A	G	10: 18,200,033	L35P	probably damaging	Het
Efcab5	A	T	11: 77,103,306	L1285Q	probably damaging	Het
Eif4g1	G	C	16: 20,681,867	R697P	probably damaging	Het
Emsy	T	A	7: 98,600,821	E753V	probably damaging	Het
Entpd3	A	G	9: 120,558,419	I227M	probably damaging	Het
Epn1	T	A	7: 5,089,998	V103E	probably damaging	Het
Esrra	T	C	19: 6,912,010	D337G	probably benign	Het
Fam129c	T	C	8: 71,603,769	M371T	possibly damaging	Het
Fam83e	A	T	7: 45,728,769	K406*	probably null	Het
Fam83e	A	T	7: 45,728,770	K406M	possibly damaging	Het
Fat2	A	G	11: 55,311,558	I230T	probably damaging	Het
Fbxl16	A	G	17: 25,816,446	I6V	probably benign	Het
Fgf23	T	C	6: 127,073,193	I55T	probably damaging	Het
Fibcd1	T	A	2: 31,821,549	D288V	probably damaging	Het
Flnb	T	C	14: 7,892,113	I594T	probably damaging	Het
Gabbr2	T	C	4: 46,739,823	E449G	probably benign	Het
Gbf1	T	G	19: 46,272,037	S1130A	possibly damaging	Het
Gipc3	T	C	10: 81,341,265	E157G	probably damaging	Het
Glra3	G	T	8: 55,940,907	A18S	probably benign	Het
Gm6625	A	C	8: 89,146,834		noncoding transcript	Het
Gpx4	A	G	10: 80,056,036		probably benign	Het
Grb10	A	G	11: 11,946,029	F264L	possibly damaging	Het
Grik3	T	C	4: 125,694,138	Y684H	probably damaging	Het
Gstp1	C	T	19: 4,036,795		probably benign	Het
Haus8	G	A	8: 71,256,123		probably benign	Het
Hip1	G	A	5: 135,435,141		probably null	Het
Hist3h2ba	A	T	11: 58,949,102	I55F	possibly damaging	Het
Hspbap1	T	A	16: 35,818,764		probably null	Het
Htr2b	T	A	1: 86,099,429	I452F	possibly damaging	Het
Hydin	T	A	8: 110,569,808	H3656Q	probably benign	Het
Klb	T	A	5: 65,348,837	D142E	probably benign	Het
Lamb3	A	T	1: 193,334,616	T777S	possibly damaging	Het
Lins1	C	A	7: 66,714,322	T650K	probably damaging	Het
Loxhd1	A	G	18: 77,281,971	K5R	possibly damaging	Het
Lpp	G	A	16: 24,761,655	M40I	probably damaging	Het
Mia2	A	T	12: 59,170,251		probably benign	Het
Miip	A	C	4: 147,863,092	F204V	probably damaging	Het
Mmp21	T	C	7: 133,677,153	R323G	probably benign	Het
Mta3	T	A	17: 83,755,551		probably benign	Het
Myh1	A	G	11: 67,213,630	K1004R	probably benign	Het
Myh14	T	A	7: 44,632,429	I810F	probably damaging	Het
Nbas	A	C	12: 13,413,597	D1295A	probably damaging	Het
Npr2	T	G	4: 43,632,384	V67G	probably benign	Het
Oas1f	C	A	5: 120,855,429	Q235K	probably damaging	Het
Olfr109	T	A	17: 37,467,047	S280R	probably damaging	Het
Olfr59	G	T	11: 74,289,213	C189F	probably damaging	Het
Olfr60	T	A	7: 140,345,987	M1L	probably benign	Het
Olfr629	T	C	7: 103,741,174	N22S	probably benign	Het
Olfr857	C	T	9: 19,713,090	H88Y	probably benign	Het
Pafah2	GCCCC	GCCCCC	4: 134,425,541		probably null	Het
Pde1b	A	G	15: 103,525,340		probably null	Het
Pdilt	T	C	7: 119,489,384	T465A	probably benign	Het
Plxnd1	T	C	6: 115,966,546	H1233R	probably damaging	Het
Ppm1b	T	A	17: 84,994,124	M144K	probably benign	Het
Prkdc	T	C	16: 15,808,058	L3316S	probably benign	Het
Prm2	T	A	16: 10,791,591		probably benign	Het
Prmt7	T	C	8: 106,237,008	V240A	probably benign	Het
Prx	C	A	7: 27,518,888	A938E	possibly damaging	Het
Rbm7	A	G	9: 48,490,894	V131A	probably benign	Het
Ric1	T	A	19: 29,600,813		probably null	Het
Rnf150	A	T	8: 82,864,010	M1L	possibly damaging	Het
Rnf20	C	T	4: 49,644,628	R298W	probably damaging	Het
Rp1	T	A	1: 4,347,232	Y1219F	possibly damaging	Het
Scn7a	A	G	2: 66,684,013		probably null	Het
Sdad1	A	G	5: 92,292,651		probably null	Het
Sept9	T	C	11: 117,353,083		probably benign	Het
Serinc3	T	C	2: 163,645,489		probably benign	Het
Shc3	C	T	13: 51,461,388	G178R	probably damaging	Het
Slc4a10	A	T	2: 62,316,606	K1090M	probably damaging	Het
Slco1a1	T	C	6: 141,923,111	I376V	probably benign	Het
Slmap	A	T	14: 26,422,574	F719L	probably benign	Het
Smgc	A	G	15: 91,859,758	N573D	possibly damaging	Het
Spx	G	A	6: 142,414,079		probably null	Het
Srrt	C	G	5: 137,296,945	E308Q	probably damaging	Het
Tas2r130	T	A	6: 131,630,597	R78S	probably benign	Het
Tchhl1	A	G	3: 93,471,101	R371G	probably damaging	Het
Teddm2	C	T	1: 153,850,448	A174T	probably benign	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Trim33	T	C	3: 103,324,640		probably benign	Het
Tspan31	A	G	10: 127,069,458	V40A	probably damaging	Het
Uevld	A	G	7: 46,945,227		probably benign	Het
Vcl	G	T	14: 21,008,995	A560S	probably benign	Het
Vmn2r24	T	A	6: 123,816,224	C837S	probably damaging	Het
Vmn2r57	C	T	7: 41,428,107	V212M	probably damaging	Het
Vtn	A	G	11: 78,500,567	R269G	probably damaging	Het
Wdcp	G	A	12: 4,850,245	V34I	possibly damaging	Het
Zc3h14	A	G	12: 98,752,832	D152G	possibly damaging	Het
Zfp189	C	T	4: 49,529,266	P123L	probably benign	Het
Zfp318	T	C	17: 46,406,055	S1038P	possibly damaging	Het
Zfp873	A	G	10: 82,060,572	D416G	probably benign	Het

Other mutations in Vps13c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Vps13c	APN	9	67945999	missense	probably benign	0.20
IGL00336:Vps13c	APN	9	67945942	missense	probably benign	0.01
IGL00418:Vps13c	APN	9	67876262	missense	probably damaging	1.00
IGL00481:Vps13c	APN	9	67860865	missense	probably damaging	1.00
IGL00491:Vps13c	APN	9	67893136	missense	probably damaging	1.00
IGL00558:Vps13c	APN	9	67937857	missense	possibly damaging	0.52
IGL00811:Vps13c	APN	9	67948181	missense	probably damaging	0.99
IGL01011:Vps13c	APN	9	67926955	missense	probably damaging	0.98
IGL01094:Vps13c	APN	9	67886284	missense	probably damaging	1.00
IGL01330:Vps13c	APN	9	67964108	missense	probably damaging	1.00
IGL01402:Vps13c	APN	9	67913204	critical splice acceptor site	probably null
IGL01404:Vps13c	APN	9	67913204	critical splice acceptor site	probably null
IGL01470:Vps13c	APN	9	67912927	splice site	probably benign
IGL01615:Vps13c	APN	9	67955781	missense	probably benign	0.01
IGL01694:Vps13c	APN	9	67895349	missense	probably damaging	1.00
IGL01752:Vps13c	APN	9	67948228	missense	probably damaging	1.00
IGL01810:Vps13c	APN	9	67955780	missense	probably benign
IGL01954:Vps13c	APN	9	67969298	missense	probably damaging	0.98
IGL01978:Vps13c	APN	9	67930643	missense	probably benign	0.03
IGL01998:Vps13c	APN	9	67955068	splice site	probably null
IGL02201:Vps13c	APN	9	67967136	missense	probably damaging	1.00
IGL02205:Vps13c	APN	9	67883454	missense	probably damaging	1.00
IGL02303:Vps13c	APN	9	67945481	splice site	probably benign
IGL02322:Vps13c	APN	9	67937901	missense	probably benign	0.02
IGL02456:Vps13c	APN	9	67952976	missense	probably damaging	1.00
IGL02474:Vps13c	APN	9	67937876	missense	probably benign	0.00
IGL02547:Vps13c	APN	9	67908019	missense	possibly damaging	0.83
IGL02640:Vps13c	APN	9	67886248	splice site	probably benign
IGL02673:Vps13c	APN	9	67878098	missense	probably damaging	1.00
IGL02721:Vps13c	APN	9	67964149	splice site	probably benign
IGL02834:Vps13c	APN	9	67937855	missense	probably benign
IGL02838:Vps13c	APN	9	67975851	missense	probably damaging	1.00
IGL03136:Vps13c	APN	9	67950310	missense	probably damaging	1.00
IGL03137:Vps13c	APN	9	67890380	missense	probably damaging	1.00
IGL03214:Vps13c	APN	9	67897195	missense	probably null	0.81
IGL03240:Vps13c	APN	9	67955047	missense	probably benign
IGL03303:Vps13c	APN	9	67934504	missense	probably benign	0.27
IGL03336:Vps13c	APN	9	67951642	missense	possibly damaging	0.76
IGL03366:Vps13c	APN	9	67946026	missense	probably benign	0.00
Derivative	UTSW	9	67930622	missense	possibly damaging	0.79
diversion	UTSW	9	67910233	missense	possibly damaging	0.93
introversion	UTSW	9	67944046	missense	probably damaging	0.98
Inversion	UTSW	9	67902839	critical splice acceptor site	probably null
subversion	UTSW	9	67908052	missense	probably damaging	1.00
Transversion	UTSW	9	67934501	missense	probably damaging	0.98
3-1:Vps13c	UTSW	9	67936373	missense	probably benign	0.00
IGL02991:Vps13c	UTSW	9	67913877	missense	probably damaging	1.00
PIT4802001:Vps13c	UTSW	9	67937786	missense	probably damaging	1.00
R0008:Vps13c	UTSW	9	67919262	missense	probably benign
R0206:Vps13c	UTSW	9	67939162	splice site	probably benign
R0288:Vps13c	UTSW	9	67927366	missense	probably damaging	0.99
R0324:Vps13c	UTSW	9	67964309	missense	possibly damaging	0.95
R0347:Vps13c	UTSW	9	67910233	missense	possibly damaging	0.93
R0374:Vps13c	UTSW	9	67886246	splice site	probably benign
R0388:Vps13c	UTSW	9	67922915	splice site	probably benign
R0409:Vps13c	UTSW	9	67951644	missense	probably benign	0.00
R0440:Vps13c	UTSW	9	67972861	missense	probably damaging	1.00
R0513:Vps13c	UTSW	9	67930735	missense	probably benign	0.02
R0520:Vps13c	UTSW	9	67945851	missense	possibly damaging	0.88
R0569:Vps13c	UTSW	9	67973719	missense	probably damaging	0.98
R0601:Vps13c	UTSW	9	67927472	missense	probably benign	0.12
R0659:Vps13c	UTSW	9	67920935	missense	probably benign	0.11
R0667:Vps13c	UTSW	9	67951573	nonsense	probably null
R0670:Vps13c	UTSW	9	67925857	missense	probably benign	0.35
R0698:Vps13c	UTSW	9	67889723	missense	probably benign	0.45
R0729:Vps13c	UTSW	9	67961649	missense	probably damaging	1.00
R0781:Vps13c	UTSW	9	67972003	missense	probably damaging	1.00
R0811:Vps13c	UTSW	9	67934476	missense	probably benign	0.06
R0812:Vps13c	UTSW	9	67934476	missense	probably benign	0.06
R0839:Vps13c	UTSW	9	67898738	missense	probably benign
R1373:Vps13c	UTSW	9	67927511	missense	probably damaging	0.99
R1396:Vps13c	UTSW	9	67955022	missense	probably benign	0.00
R1499:Vps13c	UTSW	9	67957505	missense	probably benign	0.00
R1556:Vps13c	UTSW	9	67930711	missense	probably damaging	0.98
R1560:Vps13c	UTSW	9	67936463	critical splice donor site	probably null
R1584:Vps13c	UTSW	9	67893112	missense	possibly damaging	0.74
R1654:Vps13c	UTSW	9	67951687	missense	probably damaging	1.00
R1674:Vps13c	UTSW	9	67853703	nonsense	probably null
R1676:Vps13c	UTSW	9	67926962	missense	probably benign	0.20
R1695:Vps13c	UTSW	9	67972075	nonsense	probably null
R1710:Vps13c	UTSW	9	67911529	missense	probably benign	0.00
R1769:Vps13c	UTSW	9	67965721	missense	probably benign	0.00
R1775:Vps13c	UTSW	9	67881447	missense	probably damaging	1.00
R1795:Vps13c	UTSW	9	67893985	nonsense	probably null
R1799:Vps13c	UTSW	9	67944117	missense	probably damaging	0.98
R1835:Vps13c	UTSW	9	67993013	missense	probably benign	0.08
R1903:Vps13c	UTSW	9	67894052	missense	probably damaging	1.00
R1944:Vps13c	UTSW	9	67886276	missense	probably damaging	1.00
R1945:Vps13c	UTSW	9	67886276	missense	probably damaging	1.00
R1951:Vps13c	UTSW	9	67973759	critical splice donor site	probably null
R1993:Vps13c	UTSW	9	67975856	missense	probably damaging	1.00
R2023:Vps13c	UTSW	9	67936285	splice site	probably benign
R2059:Vps13c	UTSW	9	67860833	missense	probably damaging	1.00
R2086:Vps13c	UTSW	9	67950289	missense	probably benign	0.29
R2120:Vps13c	UTSW	9	67919334	missense	possibly damaging	0.92
R2249:Vps13c	UTSW	9	67988053	critical splice donor site	probably null
R2257:Vps13c	UTSW	9	67952946	missense	possibly damaging	0.87
R2258:Vps13c	UTSW	9	67953860	missense	probably benign	0.01
R2259:Vps13c	UTSW	9	67953860	missense	probably benign	0.01
R2260:Vps13c	UTSW	9	67953860	missense	probably benign	0.01
R2265:Vps13c	UTSW	9	67920947	missense	possibly damaging	0.82
R2266:Vps13c	UTSW	9	67920947	missense	possibly damaging	0.82
R2269:Vps13c	UTSW	9	67920947	missense	possibly damaging	0.82
R2278:Vps13c	UTSW	9	67939072	missense	probably benign
R2306:Vps13c	UTSW	9	67987993	missense	probably damaging	0.99
R2327:Vps13c	UTSW	9	67913820	missense	probably damaging	0.98
R2349:Vps13c	UTSW	9	67957526	missense	possibly damaging	0.89
R2483:Vps13c	UTSW	9	67975907	critical splice donor site	probably null
R3031:Vps13c	UTSW	9	67923770	missense	probably benign	0.00
R3623:Vps13c	UTSW	9	67975907	critical splice donor site	probably null
R3870:Vps13c	UTSW	9	67884726	missense	probably benign	0.00
R4173:Vps13c	UTSW	9	67936313	missense	probably benign	0.00
R4445:Vps13c	UTSW	9	67982495	splice site	probably null
R4491:Vps13c	UTSW	9	67910193	missense	probably benign
R4505:Vps13c	UTSW	9	67939034	missense	probably benign	0.02
R4574:Vps13c	UTSW	9	67951683	missense	probably damaging	1.00
R4691:Vps13c	UTSW	9	67952935	missense	possibly damaging	0.95
R4766:Vps13c	UTSW	9	67878224	splice site	probably null
R4771:Vps13c	UTSW	9	67929539	missense	probably benign
R4801:Vps13c	UTSW	9	67964282	missense	probably damaging	1.00
R4802:Vps13c	UTSW	9	67964282	missense	probably damaging	1.00
R4962:Vps13c	UTSW	9	67873891	missense	probably damaging	1.00
R4995:Vps13c	UTSW	9	67919321	missense	probably benign	0.00
R5010:Vps13c	UTSW	9	67916379	missense	probably benign	0.19
R5183:Vps13c	UTSW	9	67908052	missense	probably damaging	1.00
R5226:Vps13c	UTSW	9	67945553	missense	probably benign	0.17
R5297:Vps13c	UTSW	9	67878131	missense	probably damaging	1.00
R5456:Vps13c	UTSW	9	67927447	missense	possibly damaging	0.53
R5494:Vps13c	UTSW	9	67948146	missense	probably benign	0.00
R5521:Vps13c	UTSW	9	67951439	missense	probably benign	0.08
R5524:Vps13c	UTSW	9	67957556	missense	probably damaging	1.00
R5685:Vps13c	UTSW	9	67963173	missense	possibly damaging	0.64
R5731:Vps13c	UTSW	9	67895379	missense	probably damaging	1.00
R5812:Vps13c	UTSW	9	67982495	splice site	probably benign
R5867:Vps13c	UTSW	9	67982622	splice site	probably null
R5893:Vps13c	UTSW	9	67902839	critical splice acceptor site	probably null
R5902:Vps13c	UTSW	9	67934447	missense	probably benign	0.00
R5957:Vps13c	UTSW	9	67954971	missense	probably damaging	1.00
R6076:Vps13c	UTSW	9	67911602	missense	probably damaging	1.00
R6187:Vps13c	UTSW	9	67915657	missense	probably damaging	1.00
R6268:Vps13c	UTSW	9	67951449	missense	probably benign	0.10
R6547:Vps13c	UTSW	9	67973365	missense	probably damaging	1.00
R6716:Vps13c	UTSW	9	67951467	missense	probably benign	0.00
R6837:Vps13c	UTSW	9	67910222	missense	probably benign
R6919:Vps13c	UTSW	9	67927452	missense	probably damaging	0.97
R7039:Vps13c	UTSW	9	67937763	missense	probably damaging	1.00
R7058:Vps13c	UTSW	9	67923828	missense	probably benign	0.39
R7082:Vps13c	UTSW	9	67883453	missense	probably damaging	1.00
R7195:Vps13c	UTSW	9	67945825	missense	possibly damaging	0.95
R7244:Vps13c	UTSW	9	67889804	missense	probably benign	0.00
R7300:Vps13c	UTSW	9	67940544	missense	probably benign	0.20
R7314:Vps13c	UTSW	9	67943340	splice site	probably null
R7352:Vps13c	UTSW	9	67840446	missense	possibly damaging	0.94
R7368:Vps13c	UTSW	9	67914073	missense	probably benign	0.23
R7411:Vps13c	UTSW	9	67972001	missense	probably damaging	0.98
R7497:Vps13c	UTSW	9	67840479	missense	probably damaging	1.00
R7516:Vps13c	UTSW	9	67955007	missense	possibly damaging	0.89
R7638:Vps13c	UTSW	9	67945509	missense	probably damaging	1.00
R7732:Vps13c	UTSW	9	67940516	missense	probably damaging	0.97
R7748:Vps13c	UTSW	9	67963089	missense	probably benign	0.03
R7779:Vps13c	UTSW	9	67881422	missense	probably damaging	1.00
R7788:Vps13c	UTSW	9	67940483	missense	probably benign	0.01
R7894:Vps13c	UTSW	9	67926983	missense	probably damaging	0.99
R8163:Vps13c	UTSW	9	67950438	missense	probably benign	0.08
R8165:Vps13c	UTSW	9	67858790	missense	probably benign	0.00
R8202:Vps13c	UTSW	9	67944046	missense	probably damaging	0.98
R8235:Vps13c	UTSW	9	67927396	missense	probably damaging	1.00
R8235:Vps13c	UTSW	9	67955781	missense	probably benign	0.01
R8253:Vps13c	UTSW	9	67943488	nonsense	probably null
R8261:Vps13c	UTSW	9	67954980	missense	probably damaging	1.00
R8348:Vps13c	UTSW	9	67879103	missense	possibly damaging	0.79
R8547:Vps13c	UTSW	9	67945566	missense	probably damaging	1.00
R8734:Vps13c	UTSW	9	67973403	missense	probably damaging	1.00
R8806:Vps13c	UTSW	9	67945828	missense	probably damaging	1.00
R8807:Vps13c	UTSW	9	67858840	missense	probably damaging	0.99
R8813:Vps13c	UTSW	9	67871284	missense	probably damaging	1.00
R8883:Vps13c	UTSW	9	67948197	missense	probably benign	0.10
R8885:Vps13c	UTSW	9	67943454	missense	probably benign
R8899:Vps13c	UTSW	9	67934501	missense	probably damaging	0.98
R8970:Vps13c	UTSW	9	67945521	missense	probably benign	0.11
R9007:Vps13c	UTSW	9	67937724	missense	probably benign	0.00
R9026:Vps13c	UTSW	9	67954581	missense	probably damaging	1.00
R9029:Vps13c	UTSW	9	67948147	missense	probably damaging	0.98
R9057:Vps13c	UTSW	9	67920927	missense	probably benign	0.00
R9105:Vps13c	UTSW	9	67870799	intron	probably benign
R9130:Vps13c	UTSW	9	67929523	missense	probably damaging	1.00
R9286:Vps13c	UTSW	9	67972921	missense	probably benign	0.00
R9338:Vps13c	UTSW	9	67951695	missense	probably damaging	1.00
R9432:Vps13c	UTSW	9	67922855	missense	probably benign	0.02
R9460:Vps13c	UTSW	9	67930622	missense	possibly damaging	0.79
R9464:Vps13c	UTSW	9	67951392	missense	probably damaging	1.00
R9561:Vps13c	UTSW	9	67965512	missense	probably damaging	1.00
R9609:Vps13c	UTSW	9	67934549	missense	probably damaging	1.00
R9622:Vps13c	UTSW	9	67949433	missense	probably damaging	1.00
R9665:Vps13c	UTSW	9	67955743	nonsense	probably null
R9731:Vps13c	UTSW	9	67919244	missense	probably benign
R9763:Vps13c	UTSW	9	67911578	missense	probably benign	0.00
R9774:Vps13c	UTSW	9	67884591	missense	possibly damaging	0.85
R9798:Vps13c	UTSW	9	67919364	missense	probably damaging	1.00
U24488:Vps13c	UTSW	9	67905916	missense	probably benign	0.13
X0021:Vps13c	UTSW	9	67937781	missense	probably damaging	0.99
X0058:Vps13c	UTSW	9	67927419	missense	probably damaging	1.00
X0065:Vps13c	UTSW	9	67873863	missense	probably damaging	1.00
Z1088:Vps13c	UTSW	9	67913975	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGCACTTAGAGACTTCGTG -3'
(R):5'- TTGTGAGACTATGGCCAAAGG -3'

Sequencing Primer
(F):5'- CTGCACTTAGAGACTTCGTGAGTTG -3'
(R):5'- AAGGCTAGACTCTTCTGAGGATCC -3'

Posted On

2014-06-23