Incidental Mutation 'R1848:Zfp873'
ID 207922
Institutional Source Beutler Lab
Gene Symbol Zfp873
Ensembl Gene ENSMUSG00000061371
Gene Name zinc finger protein 873
Synonyms
MMRRC Submission 039873-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R1848 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 81883957-81900579 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 81896406 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 416 (D416G)
Ref Sequence ENSEMBL: ENSMUSP00000148219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105313] [ENSMUST00000209622] [ENSMUST00000210325]
AlphaFold A0A1B0GT64
Predicted Effect probably benign
Transcript: ENSMUST00000105313
AA Change: D379G

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000100950
Gene: ENSMUSG00000061371
AA Change: D379G

DomainStartEndE-ValueType
ZnF_C2H2 68 90 1.12e2 SMART
ZnF_C2H2 96 117 4.69e0 SMART
ZnF_C2H2 123 145 2.06e1 SMART
ZnF_C2H2 151 173 5.5e-3 SMART
ZnF_C2H2 179 201 3.69e-4 SMART
ZnF_C2H2 207 229 3.89e-3 SMART
ZnF_C2H2 235 257 9.88e-5 SMART
ZnF_C2H2 263 285 5.59e-4 SMART
ZnF_C2H2 291 313 2.99e-4 SMART
ZnF_C2H2 319 341 1.95e-3 SMART
ZnF_C2H2 347 369 2.75e-3 SMART
ZnF_C2H2 375 397 7.37e-4 SMART
ZnF_C2H2 403 425 2.53e-2 SMART
ZnF_C2H2 431 453 9.08e-4 SMART
ZnF_C2H2 459 481 5.99e-4 SMART
ZnF_C2H2 487 509 1.22e-4 SMART
ZnF_C2H2 515 537 1.82e-3 SMART
ZnF_C2H2 543 565 2.53e-2 SMART
ZnF_C2H2 571 593 9.73e-4 SMART
ZnF_C2H2 599 619 3.13e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209614
Predicted Effect probably benign
Transcript: ENSMUST00000209622
Predicted Effect probably benign
Transcript: ENSMUST00000210325
AA Change: D416G

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219748
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency 98% (120/123)
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik C A 8: 88,295,121 (GRCm39) Y86* probably null Het
Aadac A G 3: 59,947,118 (GRCm39) E272G probably damaging Het
Abcc8 A T 7: 45,816,326 (GRCm39) D271E probably benign Het
Acan T C 7: 78,748,783 (GRCm39) F1185L probably benign Het
Adam1a A T 5: 121,657,683 (GRCm39) C537S probably damaging Het
Ago2 A G 15: 72,995,814 (GRCm39) V395A probably benign Het
Alox15 A G 11: 70,241,578 (GRCm39) V101A probably damaging Het
Ankra2 T C 13: 98,407,632 (GRCm39) I194T probably damaging Het
Apobec4 C A 1: 152,631,981 (GRCm39) P3H probably damaging Het
Arid3b G T 9: 57,703,960 (GRCm39) Y329* probably null Het
Atm A T 9: 53,379,312 (GRCm39) S1993T probably benign Het
Bpgm T G 6: 34,464,669 (GRCm39) S129A probably benign Het
Brat1 A G 5: 140,704,264 (GRCm39) D839G possibly damaging Het
Ccdc15 A T 9: 37,253,866 (GRCm39) S128T probably benign Het
Cd300lg A T 11: 101,937,032 (GRCm39) probably benign Het
Cdc34b C A 11: 94,633,303 (GRCm39) Q168K probably damaging Het
Celsr2 A T 3: 108,308,626 (GRCm39) V1767E probably benign Het
Cep350 T C 1: 155,829,397 (GRCm39) D169G probably benign Het
Col7a1 A T 9: 108,798,633 (GRCm39) D1762V possibly damaging Het
Coro7 A G 16: 4,448,298 (GRCm39) L724P probably damaging Het
Crb1 T A 1: 139,164,750 (GRCm39) I1125F probably damaging Het
Ctif T A 18: 75,653,012 (GRCm39) D415V probably damaging Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dhrs2 A G 14: 55,478,298 (GRCm39) D237G probably benign Het
Dhx9 T C 1: 153,341,499 (GRCm39) Q582R probably damaging Het
Dnajc1 C T 2: 18,224,524 (GRCm39) R443Q probably damaging Het
Dnm2 C T 9: 21,416,977 (GRCm39) R837W possibly damaging Het
Dpf2 C A 19: 5,956,643 (GRCm39) Q70H probably damaging Het
Dqx1 T A 6: 83,043,088 (GRCm39) D608E probably damaging Het
Dync2h1 T A 9: 7,049,166 (GRCm39) T3245S probably benign Het
Ect2l A G 10: 18,075,781 (GRCm39) L35P probably damaging Het
Efcab5 A T 11: 76,994,132 (GRCm39) L1285Q probably damaging Het
Eif4g1 G C 16: 20,500,617 (GRCm39) R697P probably damaging Het
Emsy T A 7: 98,250,028 (GRCm39) E753V probably damaging Het
Entpd3 A G 9: 120,387,485 (GRCm39) I227M probably damaging Het
Epn1 T A 7: 5,092,997 (GRCm39) V103E probably damaging Het
Esrra T C 19: 6,889,378 (GRCm39) D337G probably benign Het
Fam83e A T 7: 45,378,193 (GRCm39) K406* probably null Het
Fam83e A T 7: 45,378,194 (GRCm39) K406M possibly damaging Het
Fat2 A G 11: 55,202,384 (GRCm39) I230T probably damaging Het
Fbxl16 A G 17: 26,035,420 (GRCm39) I6V probably benign Het
Fgf23 T C 6: 127,050,156 (GRCm39) I55T probably damaging Het
Fibcd1 T A 2: 31,711,561 (GRCm39) D288V probably damaging Het
Flnb T C 14: 7,892,113 (GRCm38) I594T probably damaging Het
Gabbr2 T C 4: 46,739,823 (GRCm39) E449G probably benign Het
Gbf1 T G 19: 46,260,476 (GRCm39) S1130A possibly damaging Het
Gipc3 T C 10: 81,177,099 (GRCm39) E157G probably damaging Het
Glra3 G T 8: 56,393,942 (GRCm39) A18S probably benign Het
Gm6625 A C 8: 89,873,462 (GRCm39) noncoding transcript Het
Gpx4 A G 10: 79,891,870 (GRCm39) probably benign Het
Grb10 A G 11: 11,896,029 (GRCm39) F264L possibly damaging Het
Grik3 T C 4: 125,587,931 (GRCm39) Y684H probably damaging Het
Gstp1 C T 19: 4,086,795 (GRCm39) probably benign Het
H2bc27 A T 11: 58,839,928 (GRCm39) I55F possibly damaging Het
Haus8 G A 8: 71,708,767 (GRCm39) probably benign Het
Hip1 G A 5: 135,463,995 (GRCm39) probably null Het
Hspbap1 T A 16: 35,639,134 (GRCm39) probably null Het
Htr2b T A 1: 86,027,151 (GRCm39) I452F possibly damaging Het
Hydin T A 8: 111,296,440 (GRCm39) H3656Q probably benign Het
Klb T A 5: 65,506,180 (GRCm39) D142E probably benign Het
Lamb3 A T 1: 193,016,924 (GRCm39) T777S possibly damaging Het
Lins1 C A 7: 66,364,070 (GRCm39) T650K probably damaging Het
Loxhd1 A G 18: 77,369,667 (GRCm39) K5R possibly damaging Het
Lpp G A 16: 24,580,405 (GRCm39) M40I probably damaging Het
Mia2 A T 12: 59,217,037 (GRCm39) probably benign Het
Miip A C 4: 147,947,549 (GRCm39) F204V probably damaging Het
Mmp21 T C 7: 133,278,882 (GRCm39) R323G probably benign Het
Mta3 T A 17: 84,062,980 (GRCm39) probably benign Het
Myh1 A G 11: 67,104,456 (GRCm39) K1004R probably benign Het
Myh14 T A 7: 44,281,853 (GRCm39) I810F probably damaging Het
Nbas A C 12: 13,463,598 (GRCm39) D1295A probably damaging Het
Niban3 T C 8: 72,056,413 (GRCm39) M371T possibly damaging Het
Npr2 T G 4: 43,632,384 (GRCm39) V67G probably benign Het
Oas1f C A 5: 120,993,492 (GRCm39) Q235K probably damaging Het
Or12d17 T A 17: 37,777,938 (GRCm39) S280R probably damaging Het
Or13a27 T A 7: 139,925,900 (GRCm39) M1L probably benign Het
Or1p1 G T 11: 74,180,039 (GRCm39) C189F probably damaging Het
Or52ae9 T C 7: 103,390,381 (GRCm39) N22S probably benign Het
Or7e166 C T 9: 19,624,386 (GRCm39) H88Y probably benign Het
Pafah2 GCCCC GCCCCC 4: 134,152,852 (GRCm39) probably null Het
Pde1b A G 15: 103,433,767 (GRCm39) probably null Het
Pdilt T C 7: 119,088,607 (GRCm39) T465A probably benign Het
Plxnd1 T C 6: 115,943,507 (GRCm39) H1233R probably damaging Het
Ppm1b T A 17: 85,301,552 (GRCm39) M144K probably benign Het
Prkdc T C 16: 15,625,922 (GRCm39) L3316S probably benign Het
Prm2 T A 16: 10,609,455 (GRCm39) probably benign Het
Prmt7 T C 8: 106,963,640 (GRCm39) V240A probably benign Het
Prx C A 7: 27,218,313 (GRCm39) A938E possibly damaging Het
Rbm7 A G 9: 48,402,194 (GRCm39) V131A probably benign Het
Ric1 T A 19: 29,578,213 (GRCm39) probably null Het
Rnf150 A T 8: 83,590,639 (GRCm39) M1L possibly damaging Het
Rnf20 C T 4: 49,644,628 (GRCm39) R298W probably damaging Het
Rp1 T A 1: 4,417,455 (GRCm39) Y1219F possibly damaging Het
Scn7a A G 2: 66,514,357 (GRCm39) probably null Het
Sdad1 A G 5: 92,440,510 (GRCm39) probably null Het
Septin9 T C 11: 117,243,909 (GRCm39) probably benign Het
Serinc3 T C 2: 163,487,409 (GRCm39) probably benign Het
Shc3 C T 13: 51,615,424 (GRCm39) G178R probably damaging Het
Slc4a10 A T 2: 62,146,950 (GRCm39) K1090M probably damaging Het
Slco1a1 T C 6: 141,868,837 (GRCm39) I376V probably benign Het
Slmap A T 14: 26,143,729 (GRCm39) F719L probably benign Het
Smgc A G 15: 91,743,956 (GRCm39) N573D possibly damaging Het
Spx G A 6: 142,359,805 (GRCm39) probably null Het
Srrt C G 5: 137,295,207 (GRCm39) E308Q probably damaging Het
Tas2r130 T A 6: 131,607,560 (GRCm39) R78S probably benign Het
Tchhl1 A G 3: 93,378,408 (GRCm39) R371G probably damaging Het
Teddm2 C T 1: 153,726,194 (GRCm39) A174T probably benign Het
Tktl2 G A 8: 66,964,999 (GRCm39) V186M probably damaging Het
Trim33 T C 3: 103,231,956 (GRCm39) probably benign Het
Tspan31 A G 10: 126,905,327 (GRCm39) V40A probably damaging Het
Uevld A G 7: 46,594,975 (GRCm39) probably benign Het
Vcl G T 14: 21,059,063 (GRCm39) A560S probably benign Het
Vmn2r24 T A 6: 123,793,183 (GRCm39) C837S probably damaging Het
Vmn2r57 C T 7: 41,077,531 (GRCm39) V212M probably damaging Het
Vps13c A G 9: 67,843,622 (GRCm39) T1968A probably benign Het
Vtn A G 11: 78,391,393 (GRCm39) R269G probably damaging Het
Wdcp G A 12: 4,900,245 (GRCm39) V34I possibly damaging Het
Zc3h14 A G 12: 98,719,091 (GRCm39) D152G possibly damaging Het
Zfp189 C T 4: 49,529,266 (GRCm39) P123L probably benign Het
Zfp318 T C 17: 46,716,981 (GRCm39) S1038P possibly damaging Het
Other mutations in Zfp873
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02250:Zfp873 APN 10 81,894,252 (GRCm39) start codon destroyed probably null 0.45
G1Funyon:Zfp873 UTSW 10 81,896,713 (GRCm39) missense probably damaging 1.00
R0666:Zfp873 UTSW 10 81,896,595 (GRCm39) missense possibly damaging 0.75
R1568:Zfp873 UTSW 10 81,896,113 (GRCm39) missense probably damaging 1.00
R1739:Zfp873 UTSW 10 81,896,541 (GRCm39) missense probably damaging 1.00
R1892:Zfp873 UTSW 10 81,897,080 (GRCm39) missense probably damaging 1.00
R2061:Zfp873 UTSW 10 81,895,991 (GRCm39) missense probably benign 0.01
R3735:Zfp873 UTSW 10 81,897,015 (GRCm39) missense probably benign 0.15
R4422:Zfp873 UTSW 10 81,896,708 (GRCm39) missense probably benign 0.13
R4674:Zfp873 UTSW 10 81,895,814 (GRCm39) missense possibly damaging 0.53
R4839:Zfp873 UTSW 10 81,896,353 (GRCm39) missense probably damaging 0.98
R5146:Zfp873 UTSW 10 81,896,058 (GRCm39) missense probably damaging 1.00
R5154:Zfp873 UTSW 10 81,896,025 (GRCm39) missense possibly damaging 0.54
R5160:Zfp873 UTSW 10 81,896,876 (GRCm39) missense possibly damaging 0.54
R5811:Zfp873 UTSW 10 81,896,567 (GRCm39) missense probably damaging 1.00
R6625:Zfp873 UTSW 10 81,896,138 (GRCm39) missense probably damaging 1.00
R6667:Zfp873 UTSW 10 81,896,423 (GRCm39) missense probably benign 0.22
R6742:Zfp873 UTSW 10 81,894,256 (GRCm39) missense probably damaging 1.00
R6878:Zfp873 UTSW 10 81,896,529 (GRCm39) missense probably benign 0.33
R7055:Zfp873 UTSW 10 81,895,832 (GRCm39) missense probably damaging 1.00
R7296:Zfp873 UTSW 10 81,897,071 (GRCm39) missense probably damaging 1.00
R7381:Zfp873 UTSW 10 81,896,805 (GRCm39) missense probably damaging 1.00
R7448:Zfp873 UTSW 10 81,896,461 (GRCm39) missense probably damaging 1.00
R7464:Zfp873 UTSW 10 81,896,210 (GRCm39) missense possibly damaging 0.51
R7470:Zfp873 UTSW 10 81,895,773 (GRCm39) missense probably benign 0.19
R7640:Zfp873 UTSW 10 81,896,109 (GRCm39) missense possibly damaging 0.72
R7862:Zfp873 UTSW 10 81,896,109 (GRCm39) missense probably benign 0.03
R8017:Zfp873 UTSW 10 81,896,193 (GRCm39) missense probably benign 0.01
R8301:Zfp873 UTSW 10 81,896,713 (GRCm39) missense probably damaging 1.00
R8765:Zfp873 UTSW 10 81,896,072 (GRCm39) missense probably damaging 1.00
R8997:Zfp873 UTSW 10 81,896,990 (GRCm39) missense probably benign 0.03
R9305:Zfp873 UTSW 10 81,896,514 (GRCm39) missense probably benign 0.00
R9462:Zfp873 UTSW 10 81,897,131 (GRCm39) missense probably benign 0.31
Z1177:Zfp873 UTSW 10 81,896,999 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCATTGTAGTAAAGCCTTTCCA -3'
(R):5'- CCCACACTGATTGCATGCATA -3'

Sequencing Primer
(F):5'- TGTAGTAAAGCCTTTCCAAGTCCCAG -3'
(R):5'- CACTGATTGCATGCATAGGGCTTC -3'
Posted On 2014-06-23