Mutagenetix > Incidental Mutation

Incidental Mutation 'R1848:Grb10'

207924

Institutional Source

Beutler Lab

Gene Symbol

Grb10

Ensembl Gene

ENSMUSG00000020176

Gene Name

growth factor receptor bound protein 10

Synonyms

5730571D09Rik, maternally expressed gene 1, Meg1

MMRRC Submission

039873-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.436) question?

Stock #

R1848 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11930508-12038683 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 11946029 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 264 (F264L)

Ref Sequence

ENSEMBL: ENSMUSP00000105280 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093321] [ENSMUST00000109653] [ENSMUST00000109654]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000093321
AA Change: F264L

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000091011
Gene: ENSMUSG00000020176
AA Change: F264L

Domain	Start	End	E-Value	Type
low complexity region	92	119	N/A	INTRINSIC
RA	169	253	2.56e-20	SMART
PH	294	404	7.13e-10	SMART
Pfam:BPS	427	473	6.4e-31	PFAM
SH2	493	582	7.78e-30	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109653
AA Change: F264L

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000105280
Gene: ENSMUSG00000020176
AA Change: F264L

Domain	Start	End	E-Value	Type
low complexity region	92	119	N/A	INTRINSIC
RA	169	253	2.56e-20	SMART
Blast:PH	285	358	1e-44	BLAST
Pfam:BPS	381	428	3.5e-33	PFAM
SH2	447	536	7.78e-30	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109654
AA Change: F209L

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000105281
Gene: ENSMUSG00000020176
AA Change: F209L

Domain	Start	End	E-Value	Type
RA	114	198	5.45e-24	SMART
PH	239	349	7.13e-10	SMART
Pfam:BPS	372	419	5.4e-33	PFAM
SH2	438	527	7.78e-30	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142877

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148254

Meta Mutation Damage Score

0.2737

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.2%

Validation Efficiency

98% (120/123)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to a small family of adapter proteins that are known to interact with a number of receptor tyrosine kinases and signaling molecules. This gene encodes a growth factor receptor-binding protein that interacts with insulin receptors and insulin-like growth-factor receptors. Overexpression of some isoforms of the encoded protein inhibits tyrosine kinase activity and results in growth suppression. This gene is imprinted in a highly isoform- and tissue-specific manner, with expression observed from the paternal allele in the brain, and from the maternal allele in the placental trophoblasts. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2010]
PHENOTYPE: Maternal transmission of a mutant allele results in both fetal and placental overgrowth. Disproportionate overgrowth of the liver is observed. Paternal transmission of an allele lacking the differentially methylated region results in growth retardation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 120 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933402J07Rik	C	A	8: 87,568,493	Y86*	probably null	Het
Aadac	A	G	3: 60,039,697	E272G	probably damaging	Het
Abcc8	A	T	7: 46,166,902	D271E	probably benign	Het
Acan	T	C	7: 79,099,035	F1185L	probably benign	Het
Adam1a	A	T	5: 121,519,620	C537S	probably damaging	Het
Ago2	A	G	15: 73,123,965	V395A	probably benign	Het
Alox15	A	G	11: 70,350,752	V101A	probably damaging	Het
Ankra2	T	C	13: 98,271,124	I194T	probably damaging	Het
Apobec4	C	A	1: 152,756,230	P3H	probably damaging	Het
Arid3b	G	T	9: 57,796,677	Y329*	probably null	Het
Atm	A	T	9: 53,468,012	S1993T	probably benign	Het
Bpgm	T	G	6: 34,487,734	S129A	probably benign	Het
Brat1	A	G	5: 140,718,509	D839G	possibly damaging	Het
Ccdc15	A	T	9: 37,342,570	S128T	probably benign	Het
Cd300lg	A	T	11: 102,046,206		probably benign	Het
Cdc34b	C	A	11: 94,742,477	Q168K	probably damaging	Het
Celsr2	A	T	3: 108,401,310	V1767E	probably benign	Het
Cep350	T	C	1: 155,953,651	D169G	probably benign	Het
Col7a1	A	T	9: 108,969,565	D1762V	possibly damaging	Het
Coro7	A	G	16: 4,630,434	L724P	probably damaging	Het
Crb1	T	A	1: 139,237,012	I1125F	probably damaging	Het
Ctif	T	A	18: 75,519,941	D415V	probably damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dhrs2	A	G	14: 55,240,841	D237G	probably benign	Het
Dhx9	T	C	1: 153,465,753	Q582R	probably damaging	Het
Dnajc1	C	T	2: 18,219,713	R443Q	probably damaging	Het
Dnm2	C	T	9: 21,505,681	R837W	possibly damaging	Het
Dpf2	C	A	19: 5,906,615	Q70H	probably damaging	Het
Dqx1	T	A	6: 83,066,107	D608E	probably damaging	Het
Dync2h1	T	A	9: 7,049,166	T3245S	probably benign	Het
Ect2l	A	G	10: 18,200,033	L35P	probably damaging	Het
Efcab5	A	T	11: 77,103,306	L1285Q	probably damaging	Het
Eif4g1	G	C	16: 20,681,867	R697P	probably damaging	Het
Emsy	T	A	7: 98,600,821	E753V	probably damaging	Het
Entpd3	A	G	9: 120,558,419	I227M	probably damaging	Het
Epn1	T	A	7: 5,089,998	V103E	probably damaging	Het
Esrra	T	C	19: 6,912,010	D337G	probably benign	Het
Fam129c	T	C	8: 71,603,769	M371T	possibly damaging	Het
Fam83e	A	T	7: 45,728,769	K406*	probably null	Het
Fam83e	A	T	7: 45,728,770	K406M	possibly damaging	Het
Fat2	A	G	11: 55,311,558	I230T	probably damaging	Het
Fbxl16	A	G	17: 25,816,446	I6V	probably benign	Het
Fgf23	T	C	6: 127,073,193	I55T	probably damaging	Het
Fibcd1	T	A	2: 31,821,549	D288V	probably damaging	Het
Flnb	T	C	14: 7,892,113	I594T	probably damaging	Het
Gabbr2	T	C	4: 46,739,823	E449G	probably benign	Het
Gbf1	T	G	19: 46,272,037	S1130A	possibly damaging	Het
Gipc3	T	C	10: 81,341,265	E157G	probably damaging	Het
Glra3	G	T	8: 55,940,907	A18S	probably benign	Het
Gm6625	A	C	8: 89,146,834		noncoding transcript	Het
Gpx4	A	G	10: 80,056,036		probably benign	Het
Grik3	T	C	4: 125,694,138	Y684H	probably damaging	Het
Gstp1	C	T	19: 4,036,795		probably benign	Het
Haus8	G	A	8: 71,256,123		probably benign	Het
Hip1	G	A	5: 135,435,141		probably null	Het
Hist3h2ba	A	T	11: 58,949,102	I55F	possibly damaging	Het
Hspbap1	T	A	16: 35,818,764		probably null	Het
Htr2b	T	A	1: 86,099,429	I452F	possibly damaging	Het
Hydin	T	A	8: 110,569,808	H3656Q	probably benign	Het
Klb	T	A	5: 65,348,837	D142E	probably benign	Het
Lamb3	A	T	1: 193,334,616	T777S	possibly damaging	Het
Lins1	C	A	7: 66,714,322	T650K	probably damaging	Het
Loxhd1	A	G	18: 77,281,971	K5R	possibly damaging	Het
Lpp	G	A	16: 24,761,655	M40I	probably damaging	Het
Mia2	A	T	12: 59,170,251		probably benign	Het
Miip	A	C	4: 147,863,092	F204V	probably damaging	Het
Mmp21	T	C	7: 133,677,153	R323G	probably benign	Het
Mta3	T	A	17: 83,755,551		probably benign	Het
Myh1	A	G	11: 67,213,630	K1004R	probably benign	Het
Myh14	T	A	7: 44,632,429	I810F	probably damaging	Het
Nbas	A	C	12: 13,413,597	D1295A	probably damaging	Het
Npr2	T	G	4: 43,632,384	V67G	probably benign	Het
Oas1f	C	A	5: 120,855,429	Q235K	probably damaging	Het
Olfr109	T	A	17: 37,467,047	S280R	probably damaging	Het
Olfr59	G	T	11: 74,289,213	C189F	probably damaging	Het
Olfr60	T	A	7: 140,345,987	M1L	probably benign	Het
Olfr629	T	C	7: 103,741,174	N22S	probably benign	Het
Olfr857	C	T	9: 19,713,090	H88Y	probably benign	Het
Pafah2	GCCCC	GCCCCC	4: 134,425,541		probably null	Het
Pde1b	A	G	15: 103,525,340		probably null	Het
Pdilt	T	C	7: 119,489,384	T465A	probably benign	Het
Plxnd1	T	C	6: 115,966,546	H1233R	probably damaging	Het
Ppm1b	T	A	17: 84,994,124	M144K	probably benign	Het
Prkdc	T	C	16: 15,808,058	L3316S	probably benign	Het
Prm2	T	A	16: 10,791,591		probably benign	Het
Prmt7	T	C	8: 106,237,008	V240A	probably benign	Het
Prx	C	A	7: 27,518,888	A938E	possibly damaging	Het
Rbm7	A	G	9: 48,490,894	V131A	probably benign	Het
Ric1	T	A	19: 29,600,813		probably null	Het
Rnf150	A	T	8: 82,864,010	M1L	possibly damaging	Het
Rnf20	C	T	4: 49,644,628	R298W	probably damaging	Het
Rp1	T	A	1: 4,347,232	Y1219F	possibly damaging	Het
Scn7a	A	G	2: 66,684,013		probably null	Het
Sdad1	A	G	5: 92,292,651		probably null	Het
Sept9	T	C	11: 117,353,083		probably benign	Het
Serinc3	T	C	2: 163,645,489		probably benign	Het
Shc3	C	T	13: 51,461,388	G178R	probably damaging	Het
Slc4a10	A	T	2: 62,316,606	K1090M	probably damaging	Het
Slco1a1	T	C	6: 141,923,111	I376V	probably benign	Het
Slmap	A	T	14: 26,422,574	F719L	probably benign	Het
Smgc	A	G	15: 91,859,758	N573D	possibly damaging	Het
Spx	G	A	6: 142,414,079		probably null	Het
Srrt	C	G	5: 137,296,945	E308Q	probably damaging	Het
Tas2r130	T	A	6: 131,630,597	R78S	probably benign	Het
Tchhl1	A	G	3: 93,471,101	R371G	probably damaging	Het
Teddm2	C	T	1: 153,850,448	A174T	probably benign	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Trim33	T	C	3: 103,324,640		probably benign	Het
Tspan31	A	G	10: 127,069,458	V40A	probably damaging	Het
Uevld	A	G	7: 46,945,227		probably benign	Het
Vcl	G	T	14: 21,008,995	A560S	probably benign	Het
Vmn2r24	T	A	6: 123,816,224	C837S	probably damaging	Het
Vmn2r57	C	T	7: 41,428,107	V212M	probably damaging	Het
Vps13c	A	G	9: 67,936,340	T1968A	probably benign	Het
Vtn	A	G	11: 78,500,567	R269G	probably damaging	Het
Wdcp	G	A	12: 4,850,245	V34I	possibly damaging	Het
Zc3h14	A	G	12: 98,752,832	D152G	possibly damaging	Het
Zfp189	C	T	4: 49,529,266	P123L	probably benign	Het
Zfp318	T	C	17: 46,406,055	S1038P	possibly damaging	Het
Zfp873	A	G	10: 82,060,572	D416G	probably benign	Het

Other mutations in Grb10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01367:Grb10	APN	11	11945599	missense	probably damaging	1.00
IGL01450:Grb10	APN	11	11970432	missense	probably damaging	1.00
IGL01872:Grb10	APN	11	11970547	missense	probably damaging	0.99
IGL02164:Grb10	APN	11	11943962	missense	probably damaging	1.00
IGL02508:Grb10	APN	11	11946767	missense	probably damaging	1.00
IGL02626:Grb10	APN	11	11945503	missense	probably benign	0.00
IGL03275:Grb10	APN	11	11933591	missense	possibly damaging	0.46
virginia	UTSW	11	11933551	missense	probably damaging	1.00
R0042:Grb10	UTSW	11	11936798	missense	probably damaging	1.00
R0042:Grb10	UTSW	11	11936798	missense	probably damaging	1.00
R0089:Grb10	UTSW	11	11934192	splice site	probably benign
R0196:Grb10	UTSW	11	11945583	missense	probably damaging	1.00
R0419:Grb10	UTSW	11	11934207	missense	possibly damaging	0.87
R0645:Grb10	UTSW	11	11936755	missense	probably damaging	0.98
R1473:Grb10	UTSW	11	11934249	missense	probably damaging	1.00
R2025:Grb10	UTSW	11	11970576	nonsense	probably null
R4455:Grb10	UTSW	11	11967665	missense	possibly damaging	0.93
R4857:Grb10	UTSW	11	11951469	unclassified	probably benign
R5289:Grb10	UTSW	11	11944924	splice site	silent
R5522:Grb10	UTSW	11	11936746	missense	probably benign	0.05
R5696:Grb10	UTSW	11	11933566	missense	probably benign	0.23
R6119:Grb10	UTSW	11	11933551	missense	probably damaging	1.00
R6163:Grb10	UTSW	11	11943932	nonsense	probably null
R6267:Grb10	UTSW	11	11970639	start gained	probably benign
R6328:Grb10	UTSW	11	11937905	missense	probably damaging	1.00
R6741:Grb10	UTSW	11	11936717	critical splice donor site	probably null
R7610:Grb10	UTSW	11	11943955	missense	probably benign	0.33
R7641:Grb10	UTSW	11	11933492	missense	possibly damaging	0.84
R8209:Grb10	UTSW	11	11951533	missense	probably damaging	0.99
R8226:Grb10	UTSW	11	11951533	missense	probably damaging	0.99
R8916:Grb10	UTSW	11	11951599	missense	probably benign	0.28
R9546:Grb10	UTSW	11	11943919	missense	probably benign	0.00
R9547:Grb10	UTSW	11	11943919	missense	probably benign	0.00
R9559:Grb10	UTSW	11	11945535	missense	probably damaging	1.00
Z1176:Grb10	UTSW	11	11944845	missense	possibly damaging	0.59

Predicted Primers

PCR Primer
(F):5'- TACGGTGTAGTAGGAATGCTGC -3'
(R):5'- TCTGCTTCACTGTTTTCTTGGAAAG -3'

Sequencing Primer
(F):5'- CTGCTACTTTCCTTAGAAGATGGAGC -3'
(R):5'- GAAGAACTACCATCACCATGCTG -3'

Posted On

2014-06-23