Incidental Mutation 'R1848:Fat2'
ID207925
Institutional Source Beutler Lab
Gene Symbol Fat2
Ensembl Gene ENSMUSG00000055333
Gene NameFAT atypical cadherin 2
SynonymsmKIAA0811, LOC245827, Fath2, EMI2
MMRRC Submission 039873-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1848 (G1)
Quality Score202
Status Validated
Chromosome11
Chromosomal Location55250609-55336564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55311558 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 230 (I230T)
Ref Sequence ENSEMBL: ENSMUSP00000104492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068853] [ENSMUST00000108864]
Predicted Effect probably damaging
Transcript: ENSMUST00000068853
AA Change: I230T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067556
Gene: ENSMUSG00000055333
AA Change: I230T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CA 55 146 3.65e-4 SMART
CA 170 254 3.99e-10 SMART
low complexity region 337 348 N/A INTRINSIC
CA 384 456 5.11e-8 SMART
CA 480 562 2.71e-21 SMART
CA 586 664 1.12e-2 SMART
CA 737 818 1.69e-22 SMART
CA 842 923 9.59e-22 SMART
CA 947 1028 7.39e-14 SMART
CA 1054 1135 3.74e-24 SMART
CA 1159 1240 1.84e-23 SMART
CA 1266 1342 8.9e-8 SMART
CA 1368 1446 7.4e-5 SMART
CA 1470 1553 1.98e-14 SMART
CA 1577 1658 6.84e-18 SMART
CA 1682 1756 2.76e-13 SMART
CA 1787 1870 1.49e-18 SMART
CA 1894 1966 1.11e-1 SMART
CA 1990 2068 2.4e-13 SMART
CA 2092 2171 3.42e-18 SMART
CA 2190 2270 1.9e-16 SMART
CA 2294 2377 1.49e-27 SMART
CA 2401 2479 8.31e-8 SMART
CA 2503 2583 6.48e-19 SMART
CA 2607 2690 1.53e-6 SMART
CA 2714 2797 3e-14 SMART
CA 2821 2906 5.85e-26 SMART
CA 2930 3011 4.58e-19 SMART
CA 3035 3113 2.1e-27 SMART
CA 3137 3218 9.67e-18 SMART
CA 3243 3321 1.92e-12 SMART
CA 3345 3426 4.04e-29 SMART
CA 3450 3531 1.79e-12 SMART
CA 3555 3629 9.3e-2 SMART
LamG 3794 3923 1.77e-28 SMART
EGF 3952 3986 6.5e-5 SMART
EGF 3991 4024 1.6e-4 SMART
transmembrane domain 4051 4073 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108864
AA Change: I230T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104492
Gene: ENSMUSG00000055333
AA Change: I230T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CA 55 146 3.65e-4 SMART
CA 170 254 3.99e-10 SMART
low complexity region 337 348 N/A INTRINSIC
CA 384 456 5.11e-8 SMART
CA 480 562 2.71e-21 SMART
CA 586 664 1.12e-2 SMART
CA 737 818 1.69e-22 SMART
CA 842 923 9.59e-22 SMART
CA 947 1028 7.39e-14 SMART
CA 1054 1135 3.74e-24 SMART
CA 1159 1240 1.84e-23 SMART
CA 1266 1342 8.9e-8 SMART
CA 1368 1446 7.4e-5 SMART
CA 1470 1553 1.98e-14 SMART
CA 1577 1658 6.84e-18 SMART
CA 1682 1756 2.76e-13 SMART
CA 1787 1870 1.49e-18 SMART
CA 1894 1966 1.11e-1 SMART
CA 1990 2068 2.4e-13 SMART
CA 2092 2171 3.42e-18 SMART
CA 2190 2270 1.9e-16 SMART
CA 2294 2377 1.49e-27 SMART
CA 2401 2479 8.31e-8 SMART
CA 2503 2583 6.48e-19 SMART
CA 2607 2690 1.53e-6 SMART
CA 2714 2797 3e-14 SMART
CA 2821 2906 5.85e-26 SMART
CA 2930 3011 4.58e-19 SMART
CA 3035 3113 2.1e-27 SMART
CA 3137 3218 9.67e-18 SMART
CA 3243 3321 1.92e-12 SMART
CA 3345 3426 4.04e-29 SMART
CA 3450 3531 1.79e-12 SMART
CA 3555 3629 9.3e-2 SMART
LamG 3794 3923 1.77e-28 SMART
EGF 3952 3986 6.5e-5 SMART
EGF 3991 4024 1.6e-4 SMART
transmembrane domain 4051 4073 N/A INTRINSIC
Meta Mutation Damage Score 0.1365 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency 98% (120/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the second identified human homolog of the Drosophila fat gene, which encodes a tumor suppressor essential for controlling cell proliferation during Drosophila development. The gene product is a member of the cadherin superfamily, a group of integral membrane proteins characterized by the presence of cadherin-type repeats. In addition to containing 34 tandem cadherin-type repeats, the gene product has two epidermal growth factor (EGF)-like repeats and one laminin G domain. This protein most likely functions as a cell adhesion molecule, controlling cell proliferation and playing an important role in cerebellum development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are healthy, fertile and overtly normal, with no apparent defects in the development of red blood cells or platelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik C A 8: 87,568,493 Y86* probably null Het
Aadac A G 3: 60,039,697 E272G probably damaging Het
Abcc8 A T 7: 46,166,902 D271E probably benign Het
Acan T C 7: 79,099,035 F1185L probably benign Het
Adam1a A T 5: 121,519,620 C537S probably damaging Het
Ago2 A G 15: 73,123,965 V395A probably benign Het
Alox15 A G 11: 70,350,752 V101A probably damaging Het
Ankra2 T C 13: 98,271,124 I194T probably damaging Het
Apobec4 C A 1: 152,756,230 P3H probably damaging Het
Arid3b G T 9: 57,796,677 Y329* probably null Het
Atm A T 9: 53,468,012 S1993T probably benign Het
Bpgm T G 6: 34,487,734 S129A probably benign Het
Brat1 A G 5: 140,718,509 D839G possibly damaging Het
Ccdc15 A T 9: 37,342,570 S128T probably benign Het
Cd300lg A T 11: 102,046,206 probably benign Het
Cdc34b C A 11: 94,742,477 Q168K probably damaging Het
Celsr2 A T 3: 108,401,310 V1767E probably benign Het
Cep350 T C 1: 155,953,651 D169G probably benign Het
Col7a1 A T 9: 108,969,565 D1762V possibly damaging Het
Coro7 A G 16: 4,630,434 L724P probably damaging Het
Crb1 T A 1: 139,237,012 I1125F probably damaging Het
Ctif T A 18: 75,519,941 D415V probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dhrs2 A G 14: 55,240,841 D237G probably benign Het
Dhx9 T C 1: 153,465,753 Q582R probably damaging Het
Dnajc1 C T 2: 18,219,713 R443Q probably damaging Het
Dnm2 C T 9: 21,505,681 R837W possibly damaging Het
Dpf2 C A 19: 5,906,615 Q70H probably damaging Het
Dqx1 T A 6: 83,066,107 D608E probably damaging Het
Dync2h1 T A 9: 7,049,166 T3245S probably benign Het
Ect2l A G 10: 18,200,033 L35P probably damaging Het
Efcab5 A T 11: 77,103,306 L1285Q probably damaging Het
Eif4g1 G C 16: 20,681,867 R697P probably damaging Het
Emsy T A 7: 98,600,821 E753V probably damaging Het
Entpd3 A G 9: 120,558,419 I227M probably damaging Het
Epn1 T A 7: 5,089,998 V103E probably damaging Het
Esrra T C 19: 6,912,010 D337G probably benign Het
Fam129c T C 8: 71,603,769 M371T possibly damaging Het
Fam83e A T 7: 45,728,769 K406* probably null Het
Fam83e A T 7: 45,728,770 K406M possibly damaging Het
Fbxl16 A G 17: 25,816,446 I6V probably benign Het
Fgf23 T C 6: 127,073,193 I55T probably damaging Het
Fibcd1 T A 2: 31,821,549 D288V probably damaging Het
Flnb T C 14: 7,892,113 I594T probably damaging Het
Gabbr2 T C 4: 46,739,823 E449G probably benign Het
Gbf1 T G 19: 46,272,037 S1130A possibly damaging Het
Gipc3 T C 10: 81,341,265 E157G probably damaging Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm6625 A C 8: 89,146,834 noncoding transcript Het
Gpx4 A G 10: 80,056,036 probably benign Het
Grb10 A G 11: 11,946,029 F264L possibly damaging Het
Grik3 T C 4: 125,694,138 Y684H probably damaging Het
Gstp1 C T 19: 4,036,795 probably benign Het
Haus8 G A 8: 71,256,123 probably benign Het
Hip1 G A 5: 135,435,141 probably null Het
Hist3h2ba A T 11: 58,949,102 I55F possibly damaging Het
Hspbap1 T A 16: 35,818,764 probably null Het
Htr2b T A 1: 86,099,429 I452F possibly damaging Het
Hydin T A 8: 110,569,808 H3656Q probably benign Het
Klb T A 5: 65,348,837 D142E probably benign Het
Lamb3 A T 1: 193,334,616 T777S possibly damaging Het
Lins1 C A 7: 66,714,322 T650K probably damaging Het
Loxhd1 A G 18: 77,281,971 K5R possibly damaging Het
Lpp G A 16: 24,761,655 M40I probably damaging Het
Mia2 A T 12: 59,170,251 probably benign Het
Miip A C 4: 147,863,092 F204V probably damaging Het
Mmp21 T C 7: 133,677,153 R323G probably benign Het
Mta3 T A 17: 83,755,551 probably benign Het
Myh1 A G 11: 67,213,630 K1004R probably benign Het
Myh14 T A 7: 44,632,429 I810F probably damaging Het
Nbas A C 12: 13,413,597 D1295A probably damaging Het
Npr2 T G 4: 43,632,384 V67G probably benign Het
Oas1f C A 5: 120,855,429 Q235K probably damaging Het
Olfr109 T A 17: 37,467,047 S280R probably damaging Het
Olfr59 G T 11: 74,289,213 C189F probably damaging Het
Olfr60 T A 7: 140,345,987 M1L probably benign Het
Olfr629 T C 7: 103,741,174 N22S probably benign Het
Olfr857 C T 9: 19,713,090 H88Y probably benign Het
Pafah2 GCCCC GCCCCC 4: 134,425,541 probably null Het
Pde1b A G 15: 103,525,340 probably null Het
Pdilt T C 7: 119,489,384 T465A probably benign Het
Plxnd1 T C 6: 115,966,546 H1233R probably damaging Het
Ppm1b T A 17: 84,994,124 M144K probably benign Het
Prkdc T C 16: 15,808,058 L3316S probably benign Het
Prm2 T A 16: 10,791,591 probably benign Het
Prmt7 T C 8: 106,237,008 V240A probably benign Het
Prx C A 7: 27,518,888 A938E possibly damaging Het
Rbm7 A G 9: 48,490,894 V131A probably benign Het
Ric1 T A 19: 29,600,813 probably null Het
Rnf150 A T 8: 82,864,010 M1L possibly damaging Het
Rnf20 C T 4: 49,644,628 R298W probably damaging Het
Rp1 T A 1: 4,347,232 Y1219F possibly damaging Het
Scn7a A G 2: 66,684,013 probably null Het
Sdad1 A G 5: 92,292,651 probably null Het
Sept9 T C 11: 117,353,083 probably benign Het
Serinc3 T C 2: 163,645,489 probably benign Het
Shc3 C T 13: 51,461,388 G178R probably damaging Het
Slc4a10 A T 2: 62,316,606 K1090M probably damaging Het
Slco1a1 T C 6: 141,923,111 I376V probably benign Het
Slmap A T 14: 26,422,574 F719L probably benign Het
Smgc A G 15: 91,859,758 N573D possibly damaging Het
Spx G A 6: 142,414,079 probably null Het
Srrt C G 5: 137,296,945 E308Q probably damaging Het
Tas2r130 T A 6: 131,630,597 R78S probably benign Het
Tchhl1 A G 3: 93,471,101 R371G probably damaging Het
Teddm2 C T 1: 153,850,448 A174T probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Trim33 T C 3: 103,324,640 probably benign Het
Tspan31 A G 10: 127,069,458 V40A probably damaging Het
Uevld A G 7: 46,945,227 probably benign Het
Vcl G T 14: 21,008,995 A560S probably benign Het
Vmn2r24 T A 6: 123,816,224 C837S probably damaging Het
Vmn2r57 C T 7: 41,428,107 V212M probably damaging Het
Vps13c A G 9: 67,936,340 T1968A probably benign Het
Vtn A G 11: 78,500,567 R269G probably damaging Het
Wdcp G A 12: 4,850,245 V34I possibly damaging Het
Zc3h14 A G 12: 98,752,832 D152G possibly damaging Het
Zfp189 C T 4: 49,529,266 P123L probably benign Het
Zfp318 T C 17: 46,406,055 S1038P possibly damaging Het
Zfp873 A G 10: 82,060,572 D416G probably benign Het
Other mutations in Fat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00720:Fat2 APN 11 55311244 missense probably benign
IGL00897:Fat2 APN 11 55289252 missense probably damaging 0.99
IGL01161:Fat2 APN 11 55284191 missense probably benign
IGL01306:Fat2 APN 11 55310872 missense probably benign 0.28
IGL01393:Fat2 APN 11 55269309 missense probably benign 0.00
IGL01529:Fat2 APN 11 55282156 missense probably damaging 1.00
IGL01530:Fat2 APN 11 55283387 missense probably benign 0.42
IGL01555:Fat2 APN 11 55278930 missense probably damaging 0.99
IGL01758:Fat2 APN 11 55296209 missense probably damaging 1.00
IGL01768:Fat2 APN 11 55262568 missense probably damaging 1.00
IGL01939:Fat2 APN 11 55283980 missense probably benign 0.01
IGL01941:Fat2 APN 11 55312005 missense probably benign 0.01
IGL01967:Fat2 APN 11 55311823 missense probably damaging 1.00
IGL01978:Fat2 APN 11 55270146 missense probably benign 0.34
IGL01998:Fat2 APN 11 55296195 missense probably benign 0.00
IGL02001:Fat2 APN 11 55312245 start codon destroyed probably null 0.89
IGL02004:Fat2 APN 11 55282840 missense probably damaging 1.00
IGL02103:Fat2 APN 11 55289296 missense probably damaging 0.96
IGL02131:Fat2 APN 11 55309042 missense probably damaging 1.00
IGL02155:Fat2 APN 11 55262419 missense probably benign 0.00
IGL02223:Fat2 APN 11 55273129 missense probably benign 0.01
IGL02231:Fat2 APN 11 55281092 missense probably damaging 0.98
IGL02312:Fat2 APN 11 55270259 missense probably damaging 1.00
IGL02476:Fat2 APN 11 55311124 missense probably damaging 1.00
IGL02539:Fat2 APN 11 55281793 missense probably damaging 1.00
IGL02553:Fat2 APN 11 55311283 missense probably damaging 1.00
IGL02645:Fat2 APN 11 55282828 missense probably damaging 1.00
IGL02664:Fat2 APN 11 55311096 missense probably damaging 1.00
IGL02708:Fat2 APN 11 55282385 missense probably damaging 0.99
IGL02883:Fat2 APN 11 55256618 missense probably benign 0.16
IGL02894:Fat2 APN 11 55256653 missense probably damaging 1.00
IGL02975:Fat2 APN 11 55270194 missense probably benign 0.00
IGL03085:Fat2 APN 11 55283246 missense probably benign 0.09
IGL03106:Fat2 APN 11 55311901 missense probably benign 0.45
IGL03132:Fat2 APN 11 55253920 missense probably benign 0.25
IGL03133:Fat2 APN 11 55286043 missense probably benign 0.01
IGL03194:Fat2 APN 11 55310995 missense probably benign 0.02
IGL03266:Fat2 APN 11 55284029 missense possibly damaging 0.62
IGL03290:Fat2 APN 11 55256219 missense probably benign 0.33
IGL03291:Fat2 APN 11 55262595 missense probably benign
IGL03325:Fat2 APN 11 55282342 missense probably damaging 1.00
IGL03345:Fat2 APN 11 55282361 missense probably damaging 1.00
IGL03371:Fat2 APN 11 55311164 missense probably benign 0.10
ANU23:Fat2 UTSW 11 55310872 missense probably benign 0.28
P0040:Fat2 UTSW 11 55282213 missense possibly damaging 0.89
PIT4504001:Fat2 UTSW 11 55256110 missense possibly damaging 0.68
R0008:Fat2 UTSW 11 55311249 missense probably damaging 1.00
R0008:Fat2 UTSW 11 55311249 missense probably damaging 1.00
R0012:Fat2 UTSW 11 55262871 missense probably benign 0.16
R0012:Fat2 UTSW 11 55262871 missense probably benign 0.16
R0048:Fat2 UTSW 11 55310039 missense probably benign 0.00
R0048:Fat2 UTSW 11 55310039 missense probably benign 0.00
R0098:Fat2 UTSW 11 55298605 missense probably damaging 0.98
R0124:Fat2 UTSW 11 55283678 missense probably damaging 0.98
R0127:Fat2 UTSW 11 55289286 missense probably benign 0.01
R0130:Fat2 UTSW 11 55252118 missense probably benign 0.26
R0131:Fat2 UTSW 11 55273211 missense probably benign
R0158:Fat2 UTSW 11 55296185 missense probably benign 0.00
R0184:Fat2 UTSW 11 55296288 missense probably damaging 1.00
R0367:Fat2 UTSW 11 55292093 splice site probably benign
R0384:Fat2 UTSW 11 55269465 missense possibly damaging 0.81
R0390:Fat2 UTSW 11 55310777 missense probably damaging 0.99
R0403:Fat2 UTSW 11 55270349 missense probably benign 0.42
R0416:Fat2 UTSW 11 55284134 missense possibly damaging 0.94
R0437:Fat2 UTSW 11 55282799 missense probably benign 0.02
R0463:Fat2 UTSW 11 55262829 missense probably damaging 1.00
R0497:Fat2 UTSW 11 55283402 missense probably benign 0.03
R0617:Fat2 UTSW 11 55311843 missense possibly damaging 0.60
R0622:Fat2 UTSW 11 55283128 missense probably damaging 1.00
R0675:Fat2 UTSW 11 55309209 missense probably damaging 0.97
R0811:Fat2 UTSW 11 55253633 missense possibly damaging 0.75
R0812:Fat2 UTSW 11 55253633 missense possibly damaging 0.75
R0869:Fat2 UTSW 11 55311775 missense probably benign 0.08
R0870:Fat2 UTSW 11 55311775 missense probably benign 0.08
R0899:Fat2 UTSW 11 55256225 missense probably damaging 1.00
R1278:Fat2 UTSW 11 55268179 missense probably damaging 1.00
R1383:Fat2 UTSW 11 55310773 missense probably benign
R1428:Fat2 UTSW 11 55296087 missense probably damaging 1.00
R1438:Fat2 UTSW 11 55287811 missense probably damaging 1.00
R1495:Fat2 UTSW 11 55262673 missense probably benign
R1506:Fat2 UTSW 11 55284264 missense probably benign
R1547:Fat2 UTSW 11 55252255 missense probably benign 0.01
R1554:Fat2 UTSW 11 55253664 missense probably benign 0.01
R1562:Fat2 UTSW 11 55309974 missense probably damaging 1.00
R1588:Fat2 UTSW 11 55283404 missense probably damaging 1.00
R1592:Fat2 UTSW 11 55291870 splice site probably null
R1601:Fat2 UTSW 11 55282010 missense probably benign 0.01
R1610:Fat2 UTSW 11 55278924 missense probably damaging 1.00
R1634:Fat2 UTSW 11 55267684 missense probably damaging 1.00
R1634:Fat2 UTSW 11 55284719 missense probably benign
R1644:Fat2 UTSW 11 55287783 missense possibly damaging 0.91
R1644:Fat2 UTSW 11 55296181 missense possibly damaging 0.94
R1691:Fat2 UTSW 11 55311852 missense probably damaging 0.99
R1734:Fat2 UTSW 11 55281371 missense probably benign 0.00
R1748:Fat2 UTSW 11 55256647 missense probably damaging 0.97
R1771:Fat2 UTSW 11 55310865 missense probably benign 0.01
R1800:Fat2 UTSW 11 55283892 missense probably damaging 1.00
R1807:Fat2 UTSW 11 55289259 missense probably damaging 1.00
R1823:Fat2 UTSW 11 55256780 missense probably benign 0.29
R1866:Fat2 UTSW 11 55292014 missense probably benign 0.00
R1899:Fat2 UTSW 11 55262178 missense probably benign
R1954:Fat2 UTSW 11 55311084 missense probably benign 0.06
R2010:Fat2 UTSW 11 55253827 missense probably damaging 0.99
R2011:Fat2 UTSW 11 55282757 missense probably damaging 1.00
R2057:Fat2 UTSW 11 55281860 missense possibly damaging 0.60
R2081:Fat2 UTSW 11 55309677 missense possibly damaging 0.94
R2106:Fat2 UTSW 11 55256564 missense probably benign 0.00
R2165:Fat2 UTSW 11 55303716 missense probably benign 0.00
R2176:Fat2 UTSW 11 55267575 critical splice donor site probably null
R2284:Fat2 UTSW 11 55282360 missense probably damaging 1.00
R2338:Fat2 UTSW 11 55311901 missense possibly damaging 0.93
R2340:Fat2 UTSW 11 55270096 missense possibly damaging 0.90
R2427:Fat2 UTSW 11 55310812 missense probably benign 0.15
R2444:Fat2 UTSW 11 55281973 missense probably damaging 1.00
R2858:Fat2 UTSW 11 55283773 missense possibly damaging 0.94
R2882:Fat2 UTSW 11 55311305 missense probably damaging 0.96
R3029:Fat2 UTSW 11 55284709 missense probably damaging 1.00
R3085:Fat2 UTSW 11 55252171 missense possibly damaging 0.79
R3121:Fat2 UTSW 11 55311796 missense probably damaging 1.00
R3418:Fat2 UTSW 11 55278998 missense probably benign 0.01
R3500:Fat2 UTSW 11 55260516 missense probably damaging 0.99
R3607:Fat2 UTSW 11 55281685 missense probably damaging 1.00
R3611:Fat2 UTSW 11 55312069 missense probably benign
R3620:Fat2 UTSW 11 55256695 missense probably damaging 0.97
R3688:Fat2 UTSW 11 55281101 missense probably damaging 0.99
R3704:Fat2 UTSW 11 55309650 missense probably damaging 1.00
R3784:Fat2 UTSW 11 55256186 missense probably benign
R3889:Fat2 UTSW 11 55281763 missense probably damaging 1.00
R3951:Fat2 UTSW 11 55296382 missense probably benign 0.00
R4211:Fat2 UTSW 11 55283984 missense probably damaging 1.00
R4249:Fat2 UTSW 11 55284301 missense probably damaging 0.98
R4406:Fat2 UTSW 11 55262268 missense probably benign 0.00
R4433:Fat2 UTSW 11 55309640 missense possibly damaging 0.91
R4436:Fat2 UTSW 11 55296198 missense probably damaging 1.00
R4498:Fat2 UTSW 11 55270097 missense possibly damaging 0.90
R4560:Fat2 UTSW 11 55265951 missense possibly damaging 0.89
R4594:Fat2 UTSW 11 55284752 missense possibly damaging 0.78
R4663:Fat2 UTSW 11 55296213 nonsense probably null
R4669:Fat2 UTSW 11 55311615 missense probably benign 0.01
R4696:Fat2 UTSW 11 55285015 missense probably benign 0.00
R4734:Fat2 UTSW 11 55311468 missense probably benign 0.01
R4749:Fat2 UTSW 11 55311468 missense probably benign 0.01
R4765:Fat2 UTSW 11 55281187 missense probably damaging 1.00
R4803:Fat2 UTSW 11 55285060 missense probably benign 0.03
R4805:Fat2 UTSW 11 55283979 missense probably benign 0.01
R4822:Fat2 UTSW 11 55311318 missense probably benign 0.02
R4840:Fat2 UTSW 11 55279018 missense probably benign 0.21
R4849:Fat2 UTSW 11 55310637 missense probably damaging 1.00
R4943:Fat2 UTSW 11 55279033 missense probably benign 0.00
R4993:Fat2 UTSW 11 55283092 missense probably damaging 0.99
R5097:Fat2 UTSW 11 55310704 missense probably damaging 1.00
R5104:Fat2 UTSW 11 55278988 missense possibly damaging 0.93
R5115:Fat2 UTSW 11 55296333 missense probably damaging 1.00
R5213:Fat2 UTSW 11 55253832 missense probably benign 0.00
R5254:Fat2 UTSW 11 55281175 missense probably damaging 1.00
R5269:Fat2 UTSW 11 55287878 missense probably benign 0.00
R5288:Fat2 UTSW 11 55267656 missense probably benign 0.00
R5355:Fat2 UTSW 11 55282166 missense probably damaging 1.00
R5375:Fat2 UTSW 11 55262820 missense probably benign 0.00
R5379:Fat2 UTSW 11 55303941 missense probably damaging 0.99
R5411:Fat2 UTSW 11 55252226 missense probably benign 0.23
R5416:Fat2 UTSW 11 55303688 missense possibly damaging 0.77
R5480:Fat2 UTSW 11 55310086 missense probably damaging 0.99
R5486:Fat2 UTSW 11 55253681 missense probably benign 0.00
R5526:Fat2 UTSW 11 55269361 missense possibly damaging 0.90
R5532:Fat2 UTSW 11 55262337 missense probably damaging 1.00
R5583:Fat2 UTSW 11 55253889 missense probably benign 0.00
R5588:Fat2 UTSW 11 55282277 missense probably damaging 1.00
R5598:Fat2 UTSW 11 55281130 missense probably damaging 1.00
R5636:Fat2 UTSW 11 55282481 missense probably damaging 1.00
R5653:Fat2 UTSW 11 55310316 missense probably damaging 1.00
R5657:Fat2 UTSW 11 55310681 nonsense probably null
R5660:Fat2 UTSW 11 55284176 missense probably benign 0.00
R5752:Fat2 UTSW 11 55289237 missense possibly damaging 0.48
R5757:Fat2 UTSW 11 55252346 missense probably damaging 1.00
R5792:Fat2 UTSW 11 55262325 missense possibly damaging 0.77
R5872:Fat2 UTSW 11 55270382 missense probably damaging 1.00
R5933:Fat2 UTSW 11 55284051 missense probably damaging 1.00
R6030:Fat2 UTSW 11 55310303 nonsense probably null
R6030:Fat2 UTSW 11 55310303 nonsense probably null
R6032:Fat2 UTSW 11 55253934 missense probably damaging 1.00
R6032:Fat2 UTSW 11 55253934 missense probably damaging 1.00
R6221:Fat2 UTSW 11 55296072 critical splice donor site probably null
R6253:Fat2 UTSW 11 55296271 missense probably damaging 1.00
R6257:Fat2 UTSW 11 55262581 missense probably benign
R6307:Fat2 UTSW 11 55281280 missense possibly damaging 0.63
R6450:Fat2 UTSW 11 55289310 missense probably damaging 0.97
R6453:Fat2 UTSW 11 55282216 missense probably benign 0.29
R6455:Fat2 UTSW 11 55270457 missense probably damaging 0.96
R6483:Fat2 UTSW 11 55296345 missense probably damaging 1.00
R6504:Fat2 UTSW 11 55262397 missense probably benign 0.00
R6520:Fat2 UTSW 11 55284988 missense probably damaging 0.99
R6525:Fat2 UTSW 11 55283800 missense probably damaging 1.00
R6617:Fat2 UTSW 11 55296105 missense probably benign 0.01
R6652:Fat2 UTSW 11 55252262 missense probably benign
R6679:Fat2 UTSW 11 55309305 missense probably damaging 1.00
R6680:Fat2 UTSW 11 55310858 nonsense probably null
R6762:Fat2 UTSW 11 55253482 intron probably null
R6810:Fat2 UTSW 11 55282241 missense possibly damaging 0.88
R6818:Fat2 UTSW 11 55309341 missense probably benign 0.31
R6919:Fat2 UTSW 11 55282771 missense possibly damaging 0.68
R6939:Fat2 UTSW 11 55252474 nonsense probably null
R6941:Fat2 UTSW 11 55262088 missense probably benign
R7023:Fat2 UTSW 11 55310502 missense probably benign 0.00
R7027:Fat2 UTSW 11 55269433 missense probably benign 0.03
R7027:Fat2 UTSW 11 55281851 nonsense probably null
R7095:Fat2 UTSW 11 55311331 missense probably damaging 1.00
R7102:Fat2 UTSW 11 55283434 missense probably damaging 1.00
R7116:Fat2 UTSW 11 55282336 missense probably damaging 1.00
R7117:Fat2 UTSW 11 55281262 missense probably damaging 1.00
R7167:Fat2 UTSW 11 55285001 missense possibly damaging 0.48
R7213:Fat2 UTSW 11 55281045 nonsense probably null
R7246:Fat2 UTSW 11 55296382 missense probably benign 0.00
R7252:Fat2 UTSW 11 55311262 missense probably damaging 0.98
R7266:Fat2 UTSW 11 55285030 missense probably damaging 0.99
R7316:Fat2 UTSW 11 55286067 missense probably damaging 1.00
R7326:Fat2 UTSW 11 55282304 missense probably damaging 0.99
R7355:Fat2 UTSW 11 55256551 missense probably benign 0.00
R7431:Fat2 UTSW 11 55309101 missense probably damaging 1.00
R7459:Fat2 UTSW 11 55303919 missense probably damaging 1.00
R7460:Fat2 UTSW 11 55278963 missense probably damaging 1.00
R7466:Fat2 UTSW 11 55310432 missense probably damaging 1.00
R7475:Fat2 UTSW 11 55303653 missense probably benign 0.31
R7678:Fat2 UTSW 11 55282330 missense probably damaging 0.99
R7689:Fat2 UTSW 11 55309840 missense probably damaging 1.00
R7704:Fat2 UTSW 11 55284347 missense probably benign 0.03
R7710:Fat2 UTSW 11 55310763 missense probably benign 0.35
R7724:Fat2 UTSW 11 55284796 missense probably damaging 1.00
R7731:Fat2 UTSW 11 55310706 missense probably damaging 1.00
X0010:Fat2 UTSW 11 55252260 missense probably benign 0.00
X0011:Fat2 UTSW 11 55310431 missense probably damaging 0.98
X0018:Fat2 UTSW 11 55296210 missense probably damaging 1.00
X0028:Fat2 UTSW 11 55309414 missense possibly damaging 0.84
X0067:Fat2 UTSW 11 55283234 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CTTTGAAGTACTTTCCAGGGTCAC -3'
(R):5'- GCAAAGTCACTGCCACAGATG -3'

Sequencing Primer
(F):5'- CTCCAGAGAATCTACTTCAGCTC -3'
(R):5'- CTGCCACAGATGCCGATC -3'
Posted On2014-06-23