Incidental Mutation 'R1848:Sept9'
ID 207934
Institutional Source Beutler Lab
Gene Symbol Sept9
Ensembl Gene ENSMUSG00000059248
Gene Name septin 9
Synonyms PNUTL4, Msf, Sint1, SL3-3 integration site 1, MSF1
MMRRC Submission 039873-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1848 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 117199661-117362325 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 117353083 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019038] [ENSMUST00000093907] [ENSMUST00000100193] [ENSMUST00000106349] [ENSMUST00000106354] [ENSMUST00000127383] [ENSMUST00000153668]
AlphaFold Q80UG5
Predicted Effect probably benign
Transcript: ENSMUST00000019038
SMART Domains Protein: ENSMUSP00000019038
Gene: ENSMUSG00000059248

DomainStartEndE-ValueType
Pfam:DUF258 265 379 5.3e-8 PFAM
Pfam:Septin 286 565 1.2e-112 PFAM
Pfam:GTP_EFTU 289 365 1.5e-5 PFAM
Pfam:AIG1 290 379 3.1e-7 PFAM
Pfam:MMR_HSR1 291 481 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093907
SMART Domains Protein: ENSMUSP00000091435
Gene: ENSMUSG00000059248

DomainStartEndE-ValueType
Pfam:Septin 293 572 1.6e-112 PFAM
Pfam:MMR_HSR1 298 444 3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100193
SMART Domains Protein: ENSMUSP00000097767
Gene: ENSMUSG00000059248

DomainStartEndE-ValueType
Pfam:DUF258 23 138 1.1e-8 PFAM
Pfam:Septin 44 323 3.4e-113 PFAM
Pfam:GTP_EFTU 47 123 6.2e-6 PFAM
Pfam:AIG1 48 138 2.4e-7 PFAM
Pfam:MMR_HSR1 49 194 4.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106349
SMART Domains Protein: ENSMUSP00000101956
Gene: ENSMUSG00000059248

DomainStartEndE-ValueType
Pfam:DUF258 23 138 1.1e-8 PFAM
Pfam:Septin 44 323 3.4e-113 PFAM
Pfam:GTP_EFTU 47 123 6.2e-6 PFAM
Pfam:AIG1 48 138 2.4e-7 PFAM
Pfam:MMR_HSR1 49 194 4.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106354
SMART Domains Protein: ENSMUSP00000101961
Gene: ENSMUSG00000059248

DomainStartEndE-ValueType
Pfam:DUF258 254 368 4.2e-8 PFAM
Pfam:Septin 275 554 3.4e-113 PFAM
Pfam:GTP_EFTU 278 354 3.7e-6 PFAM
Pfam:AIG1 279 368 1.9e-7 PFAM
Pfam:MMR_HSR1 280 378 7.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127383
SMART Domains Protein: ENSMUSP00000120065
Gene: ENSMUSG00000059248

DomainStartEndE-ValueType
Pfam:DUF258 43 158 1.2e-8 PFAM
Pfam:Septin 63 242 6.2e-79 PFAM
Pfam:GTP_EFTU 66 142 9.2e-7 PFAM
Pfam:AIG1 67 161 4.2e-8 PFAM
Pfam:MMR_HSR1 68 222 8.9e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134852
Predicted Effect probably benign
Transcript: ENSMUST00000153668
SMART Domains Protein: ENSMUSP00000120382
Gene: ENSMUSG00000059248

DomainStartEndE-ValueType
Pfam:DUF258 16 74 1.2e-7 PFAM
Pfam:Septin 44 74 4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155331
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency 98% (120/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality around E10 with generalized apoptotic degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik C A 8: 87,568,493 Y86* probably null Het
Aadac A G 3: 60,039,697 E272G probably damaging Het
Abcc8 A T 7: 46,166,902 D271E probably benign Het
Acan T C 7: 79,099,035 F1185L probably benign Het
Adam1a A T 5: 121,519,620 C537S probably damaging Het
Ago2 A G 15: 73,123,965 V395A probably benign Het
Alox15 A G 11: 70,350,752 V101A probably damaging Het
Ankra2 T C 13: 98,271,124 I194T probably damaging Het
Apobec4 C A 1: 152,756,230 P3H probably damaging Het
Arid3b G T 9: 57,796,677 Y329* probably null Het
Atm A T 9: 53,468,012 S1993T probably benign Het
Bpgm T G 6: 34,487,734 S129A probably benign Het
Brat1 A G 5: 140,718,509 D839G possibly damaging Het
Ccdc15 A T 9: 37,342,570 S128T probably benign Het
Cd300lg A T 11: 102,046,206 probably benign Het
Cdc34b C A 11: 94,742,477 Q168K probably damaging Het
Celsr2 A T 3: 108,401,310 V1767E probably benign Het
Cep350 T C 1: 155,953,651 D169G probably benign Het
Col7a1 A T 9: 108,969,565 D1762V possibly damaging Het
Coro7 A G 16: 4,630,434 L724P probably damaging Het
Crb1 T A 1: 139,237,012 I1125F probably damaging Het
Ctif T A 18: 75,519,941 D415V probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dhrs2 A G 14: 55,240,841 D237G probably benign Het
Dhx9 T C 1: 153,465,753 Q582R probably damaging Het
Dnajc1 C T 2: 18,219,713 R443Q probably damaging Het
Dnm2 C T 9: 21,505,681 R837W possibly damaging Het
Dpf2 C A 19: 5,906,615 Q70H probably damaging Het
Dqx1 T A 6: 83,066,107 D608E probably damaging Het
Dync2h1 T A 9: 7,049,166 T3245S probably benign Het
Ect2l A G 10: 18,200,033 L35P probably damaging Het
Efcab5 A T 11: 77,103,306 L1285Q probably damaging Het
Eif4g1 G C 16: 20,681,867 R697P probably damaging Het
Emsy T A 7: 98,600,821 E753V probably damaging Het
Entpd3 A G 9: 120,558,419 I227M probably damaging Het
Epn1 T A 7: 5,089,998 V103E probably damaging Het
Esrra T C 19: 6,912,010 D337G probably benign Het
Fam129c T C 8: 71,603,769 M371T possibly damaging Het
Fam83e A T 7: 45,728,769 K406* probably null Het
Fam83e A T 7: 45,728,770 K406M possibly damaging Het
Fat2 A G 11: 55,311,558 I230T probably damaging Het
Fbxl16 A G 17: 25,816,446 I6V probably benign Het
Fgf23 T C 6: 127,073,193 I55T probably damaging Het
Fibcd1 T A 2: 31,821,549 D288V probably damaging Het
Flnb T C 14: 7,892,113 I594T probably damaging Het
Gabbr2 T C 4: 46,739,823 E449G probably benign Het
Gbf1 T G 19: 46,272,037 S1130A possibly damaging Het
Gipc3 T C 10: 81,341,265 E157G probably damaging Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm6625 A C 8: 89,146,834 noncoding transcript Het
Gpx4 A G 10: 80,056,036 probably benign Het
Grb10 A G 11: 11,946,029 F264L possibly damaging Het
Grik3 T C 4: 125,694,138 Y684H probably damaging Het
Gstp1 C T 19: 4,036,795 probably benign Het
Haus8 G A 8: 71,256,123 probably benign Het
Hip1 G A 5: 135,435,141 probably null Het
Hist3h2ba A T 11: 58,949,102 I55F possibly damaging Het
Hspbap1 T A 16: 35,818,764 probably null Het
Htr2b T A 1: 86,099,429 I452F possibly damaging Het
Hydin T A 8: 110,569,808 H3656Q probably benign Het
Klb T A 5: 65,348,837 D142E probably benign Het
Lamb3 A T 1: 193,334,616 T777S possibly damaging Het
Lins1 C A 7: 66,714,322 T650K probably damaging Het
Loxhd1 A G 18: 77,281,971 K5R possibly damaging Het
Lpp G A 16: 24,761,655 M40I probably damaging Het
Mia2 A T 12: 59,170,251 probably benign Het
Miip A C 4: 147,863,092 F204V probably damaging Het
Mmp21 T C 7: 133,677,153 R323G probably benign Het
Mta3 T A 17: 83,755,551 probably benign Het
Myh1 A G 11: 67,213,630 K1004R probably benign Het
Myh14 T A 7: 44,632,429 I810F probably damaging Het
Nbas A C 12: 13,413,597 D1295A probably damaging Het
Npr2 T G 4: 43,632,384 V67G probably benign Het
Oas1f C A 5: 120,855,429 Q235K probably damaging Het
Olfr109 T A 17: 37,467,047 S280R probably damaging Het
Olfr59 G T 11: 74,289,213 C189F probably damaging Het
Olfr60 T A 7: 140,345,987 M1L probably benign Het
Olfr629 T C 7: 103,741,174 N22S probably benign Het
Olfr857 C T 9: 19,713,090 H88Y probably benign Het
Pafah2 GCCCC GCCCCC 4: 134,425,541 probably null Het
Pde1b A G 15: 103,525,340 probably null Het
Pdilt T C 7: 119,489,384 T465A probably benign Het
Plxnd1 T C 6: 115,966,546 H1233R probably damaging Het
Ppm1b T A 17: 84,994,124 M144K probably benign Het
Prkdc T C 16: 15,808,058 L3316S probably benign Het
Prm2 T A 16: 10,791,591 probably benign Het
Prmt7 T C 8: 106,237,008 V240A probably benign Het
Prx C A 7: 27,518,888 A938E possibly damaging Het
Rbm7 A G 9: 48,490,894 V131A probably benign Het
Ric1 T A 19: 29,600,813 probably null Het
Rnf150 A T 8: 82,864,010 M1L possibly damaging Het
Rnf20 C T 4: 49,644,628 R298W probably damaging Het
Rp1 T A 1: 4,347,232 Y1219F possibly damaging Het
Scn7a A G 2: 66,684,013 probably null Het
Sdad1 A G 5: 92,292,651 probably null Het
Serinc3 T C 2: 163,645,489 probably benign Het
Shc3 C T 13: 51,461,388 G178R probably damaging Het
Slc4a10 A T 2: 62,316,606 K1090M probably damaging Het
Slco1a1 T C 6: 141,923,111 I376V probably benign Het
Slmap A T 14: 26,422,574 F719L probably benign Het
Smgc A G 15: 91,859,758 N573D possibly damaging Het
Spx G A 6: 142,414,079 probably null Het
Srrt C G 5: 137,296,945 E308Q probably damaging Het
Tas2r130 T A 6: 131,630,597 R78S probably benign Het
Tchhl1 A G 3: 93,471,101 R371G probably damaging Het
Teddm2 C T 1: 153,850,448 A174T probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Trim33 T C 3: 103,324,640 probably benign Het
Tspan31 A G 10: 127,069,458 V40A probably damaging Het
Uevld A G 7: 46,945,227 probably benign Het
Vcl G T 14: 21,008,995 A560S probably benign Het
Vmn2r24 T A 6: 123,816,224 C837S probably damaging Het
Vmn2r57 C T 7: 41,428,107 V212M probably damaging Het
Vps13c A G 9: 67,936,340 T1968A probably benign Het
Vtn A G 11: 78,500,567 R269G probably damaging Het
Wdcp G A 12: 4,850,245 V34I possibly damaging Het
Zc3h14 A G 12: 98,752,832 D152G possibly damaging Het
Zfp189 C T 4: 49,529,266 P123L probably benign Het
Zfp318 T C 17: 46,406,055 S1038P possibly damaging Het
Zfp873 A G 10: 82,060,572 D416G probably benign Het
Other mutations in Sept9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Sept9 APN 11 117352184 missense probably damaging 1.00
IGL00230:Sept9 APN 11 117354804 unclassified probably benign
IGL01520:Sept9 APN 11 117352643 missense probably damaging 1.00
IGL01905:Sept9 APN 11 117218889 missense probably benign 0.07
IGL02502:Sept9 APN 11 117290662 missense probably damaging 1.00
R0325:Sept9 UTSW 11 117356632 missense probably damaging 0.99
R0825:Sept9 UTSW 11 117359460 missense probably damaging 1.00
R0845:Sept9 UTSW 11 117356325 unclassified probably benign
R1581:Sept9 UTSW 11 117290595 missense probably damaging 1.00
R1763:Sept9 UTSW 11 117290428 missense probably benign 0.04
R2039:Sept9 UTSW 11 117351617 missense probably damaging 1.00
R2409:Sept9 UTSW 11 117360461 missense probably damaging 1.00
R2763:Sept9 UTSW 11 117326501 missense probably benign 0.05
R3545:Sept9 UTSW 11 117352673 missense probably damaging 1.00
R4062:Sept9 UTSW 11 117352265 missense probably damaging 1.00
R4601:Sept9 UTSW 11 117360484 missense probably damaging 1.00
R5139:Sept9 UTSW 11 117356685 missense possibly damaging 0.80
R5759:Sept9 UTSW 11 117352268 missense probably benign 0.15
R6062:Sept9 UTSW 11 117290800 missense possibly damaging 0.89
R6134:Sept9 UTSW 11 117352161 missense probably damaging 1.00
R6509:Sept9 UTSW 11 117290427 missense probably benign
R7562:Sept9 UTSW 11 117326511 critical splice donor site probably null
R7573:Sept9 UTSW 11 117199745 start gained probably benign
R7592:Sept9 UTSW 11 117290662 missense probably damaging 1.00
R7810:Sept9 UTSW 11 117359438 nonsense probably null
R8200:Sept9 UTSW 11 117232716 missense probably benign 0.01
R9118:Sept9 UTSW 11 117266572 missense probably benign
R9131:Sept9 UTSW 11 117290634 missense probably damaging 1.00
R9220:Sept9 UTSW 11 117351570 missense probably benign 0.05
R9241:Sept9 UTSW 11 117218898 missense probably benign 0.00
R9661:Sept9 UTSW 11 117354925 missense possibly damaging 0.91
R9735:Sept9 UTSW 11 117354854 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCAGCATGGGGAGTATGGC -3'
(R):5'- ATCCTGCTTGTATGGGAACTG -3'

Sequencing Primer
(F):5'- CATGGGGAGTATGGCAGAAAATC -3'
(R):5'- GGGATTCCCACCATCAAGAC -3'
Posted On 2014-06-23