Mutagenetix > Incidental Mutation

Incidental Mutation 'R1850:Atf6'

207974

Institutional Source

Beutler Lab

Gene Symbol

Atf6

Ensembl Gene

ENSMUSG00000026663

Gene Name

activating transcription factor 6

Synonyms

9130025P16Rik, ESTM49, Atf6alpha

MMRRC Submission

039874-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.139) question?

Stock #

R1850 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

170704674-170867771 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 170819286 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 339 (N339K)

Ref Sequence

ENSEMBL: ENSMUSP00000027974 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027974]

AlphaFold

F6VAN0

Predicted Effect

probably damaging
Transcript: ENSMUST00000027974
AA Change: N339K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027974
Gene: ENSMUSG00000026663
AA Change: N339K

Domain	Start	End	E-Value	Type
low complexity region	78	101	N/A	INTRINSIC
low complexity region	109	121	N/A	INTRINSIC
low complexity region	168	178	N/A	INTRINSIC
BRLZ	291	355	2.72e-16	SMART
Blast:BRLZ	384	419	5e-6	BLAST
low complexity region	445	457	N/A	INTRINSIC
low complexity region	631	650	N/A	INTRINSIC

Meta Mutation Damage Score

0.8390

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.8%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to dithiothreitol, thapsigargin, and tunicamycin. Mice homozygous for a conditional allele activated in islet cells exhibit reduced sensitivity to TUDCA. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4430402I18Rik	T	C	19: 28,939,171		probably null	Het
6030419C18Rik	A	T	9: 58,499,109	M101L	probably benign	Het
Adam28	T	A	14: 68,639,195	Q202L	probably benign	Het
Adgb	C	A	10: 10,442,502	V199F	probably damaging	Het
Aff1	G	T	5: 103,833,907	R645S	probably damaging	Het
Aoc1	C	T	6: 48,905,268	S48F	probably benign	Het
Bpifb3	C	G	2: 153,929,344	S392C	possibly damaging	Het
Camk1d	T	C	2: 5,362,015	M130V	probably benign	Het
Ces1a	T	A	8: 93,027,326	N350Y	probably damaging	Het
Cfap57	G	A	4: 118,599,894	R453C	probably damaging	Het
Chd4	T	A	6: 125,121,656	N1532K	probably damaging	Het
Chd5	T	C	4: 152,370,533	L824P	probably damaging	Het
Ckap5	G	A	2: 91,595,713	R1306H	probably damaging	Het
Crybg1	A	G	10: 43,997,674	F1146S	probably damaging	Het
Dusp12	G	A	1: 170,880,629	T173M	probably benign	Het
Dync2h1	T	C	9: 7,001,448	T3854A	probably benign	Het
Echdc1	A	T	10: 29,344,603	I252F	probably damaging	Het
Emc1	A	T	4: 139,359,373		probably benign	Het
Fbn2	C	A	18: 58,039,305		probably benign	Het
Fsip2	T	A	2: 82,984,589	N3555K	possibly damaging	Het
Gabra1	T	A	11: 42,179,576	T20S	probably benign	Het
H2afy	T	C	13: 56,096,239		probably benign	Het
Igf1	A	C	10: 87,861,374	T2P	possibly damaging	Het
Jcad	C	A	18: 4,675,730	T1164N	possibly damaging	Het
Kalrn	A	T	16: 33,975,923	S2830T	probably damaging	Het
Lepr	C	A	4: 101,733,423	A66E	possibly damaging	Het
Lmntd1	T	A	6: 145,413,480	M315L	probably benign	Het
Lrch3	A	G	16: 32,986,793	T479A	probably benign	Het
Matr3	A	G	18: 35,582,057	N237D	probably damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Mtif2	A	G	11: 29,540,683	I462M	probably benign	Het
Nrip1	T	C	16: 76,293,344	I442V	probably damaging	Het
Olfr1082	A	T	2: 86,594,104	C241*	probably null	Het
Olfr1415	T	A	1: 92,491,402	M118L	possibly damaging	Het
Olfr741	G	A	14: 50,485,598	A47T	probably benign	Het
Otogl	T	A	10: 107,878,064	Y498F	probably damaging	Het
Pbx3	A	T	2: 34,176,820	F351I	probably benign	Het
Pcdh18	T	C	3: 49,756,405	T154A	probably benign	Het
Pex5l	A	T	3: 32,950,876		probably null	Het
Plec	T	C	15: 76,188,232	I718V	probably benign	Het
Pparg	T	A	6: 115,450,980	Y143N	probably damaging	Het
Prl2c5	A	G	13: 13,185,792	I12V	probably benign	Het
Rcor3	T	A	1: 192,120,111	Q246L	probably benign	Het
Rnf214	A	T	9: 45,869,448		probably benign	Het
S1pr5	A	T	9: 21,244,129	S334T	probably benign	Het
Scg3	C	T	9: 75,682,167	S35N	possibly damaging	Het
Sept5	A	T	16: 18,625,210	L19Q	probably damaging	Het
Serpinb7	T	C	1: 107,428,295	F16S	probably damaging	Het
Sipa1l3	A	T	7: 29,339,126	S365R	probably damaging	Het
Slc27a1	T	C	8: 71,580,703		probably null	Het
Slc2a10	C	A	2: 165,515,213	H264Q	probably benign	Het
Slc9a3	A	G	13: 74,161,770	I526V	probably benign	Het
Smchd1	T	C	17: 71,389,771	D1203G	probably damaging	Het
Sult1b1	A	G	5: 87,520,841	W181R	probably damaging	Het
Supt6	A	G	11: 78,219,877		probably benign	Het
Tcf12	C	A	9: 71,868,215	A418S	probably damaging	Het
Tesk1	C	T	4: 43,443,576	R48C	probably damaging	Het
Tiam2	A	G	17: 3,437,235	Q677R	probably damaging	Het
Tspan8	C	T	10: 115,833,225	A55V	probably damaging	Het
Txndc11	T	C	16: 11,088,404	N421D	probably damaging	Het
Vmn1r201	A	G	13: 22,474,631	N5S	probably benign	Het
Vmn2r120	T	A	17: 57,525,826	I118L	probably benign	Het
Vps13b	A	T	15: 35,674,959		probably benign	Het
Wdfy3	A	G	5: 101,894,999	V1962A	probably damaging	Het
Zswim8	C	T	14: 20,710,747	R107*	probably null	Het

Other mutations in Atf6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Atf6	APN	1	170788606	critical splice donor site	probably null
IGL01431:Atf6	APN	1	170853002	splice site	probably benign
IGL01755:Atf6	APN	1	170788611	missense	possibly damaging	0.63
IGL02060:Atf6	APN	1	170819420	missense	probably damaging	0.99
IGL02416:Atf6	APN	1	170747157	nonsense	probably null
IGL02903:Atf6	APN	1	170799714	missense	probably benign	0.00
IGL02989:Atf6	APN	1	170788683	splice site	probably benign
IGL03209:Atf6	APN	1	170834894	missense	probably benign
R0455:Atf6	UTSW	1	170834923	missense	probably benign	0.00
R0467:Atf6	UTSW	1	170794020	missense	probably damaging	1.00
R0491:Atf6	UTSW	1	170787344	critical splice donor site	probably null
R0784:Atf6	UTSW	1	170709947	missense	probably benign	0.19
R1486:Atf6	UTSW	1	170794691	missense	probably damaging	1.00
R1945:Atf6	UTSW	1	170855141	missense	probably benign	0.00
R2164:Atf6	UTSW	1	170794735	missense	probably damaging	1.00
R3782:Atf6	UTSW	1	170794767	nonsense	probably null
R4454:Atf6	UTSW	1	170794039	missense	probably damaging	0.99
R4631:Atf6	UTSW	1	170747197	splice site	probably null
R4676:Atf6	UTSW	1	170787410	missense	probably damaging	1.00
R5772:Atf6	UTSW	1	170747189	missense	probably damaging	1.00
R5860:Atf6	UTSW	1	170841775	missense	probably damaging	1.00
R5860:Atf6	UTSW	1	170841776	missense	possibly damaging	0.95
R5950:Atf6	UTSW	1	170834879	missense	probably damaging	1.00
R6242:Atf6	UTSW	1	170793976	missense	possibly damaging	0.46
R6520:Atf6	UTSW	1	170867669	missense	probably benign	0.00
R7032:Atf6	UTSW	1	170799612	critical splice donor site	probably null
R7472:Atf6	UTSW	1	170815491	missense	possibly damaging	0.83
R7923:Atf6	UTSW	1	170794706	missense	probably benign
R8002:Atf6	UTSW	1	170819254	missense	probably benign	0.43
R8860:Atf6	UTSW	1	170852966	missense	probably null	0.95
R8956:Atf6	UTSW	1	170794007	missense	probably damaging	0.98
R9090:Atf6	UTSW	1	170794676	missense	probably damaging	1.00
R9271:Atf6	UTSW	1	170794676	missense	probably damaging	1.00
R9323:Atf6	UTSW	1	170855113	nonsense	probably null
R9500:Atf6	UTSW	1	170747139	missense	probably damaging	0.98
R9594:Atf6	UTSW	1	170840833	missense	probably benign	0.18
R9733:Atf6	UTSW	1	170834833	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAACATCTCCAAAGGGTCACTG -3'
(R):5'- TGGTACCATGATTCTGTGTGCC -3'

Sequencing Primer
(F):5'- ACATCTCCAAAGGGTCACTGTTATC -3'
(R):5'- GCCGTGTAACTTCTAGATCGCTG -3'

Posted On

2014-06-23