Incidental Mutation 'R1850:Atf6'
ID 207974
Institutional Source Beutler Lab
Gene Symbol Atf6
Ensembl Gene ENSMUSG00000026663
Gene Name activating transcription factor 6
Synonyms Atf6alpha, 9130025P16Rik, ESTM49
MMRRC Submission 039874-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.183) question?
Stock # R1850 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 170532243-170695340 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 170646855 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 339 (N339K)
Ref Sequence ENSEMBL: ENSMUSP00000027974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027974]
AlphaFold F6VAN0
Predicted Effect probably damaging
Transcript: ENSMUST00000027974
AA Change: N339K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027974
Gene: ENSMUSG00000026663
AA Change: N339K

DomainStartEndE-ValueType
low complexity region 78 101 N/A INTRINSIC
low complexity region 109 121 N/A INTRINSIC
low complexity region 168 178 N/A INTRINSIC
BRLZ 291 355 2.72e-16 SMART
Blast:BRLZ 384 419 5e-6 BLAST
low complexity region 445 457 N/A INTRINSIC
low complexity region 631 650 N/A INTRINSIC
Meta Mutation Damage Score 0.8390 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to dithiothreitol, thapsigargin, and tunicamycin. Mice homozygous for a conditional allele activated in islet cells exhibit reduced sensitivity to TUDCA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam28 T A 14: 68,876,644 (GRCm39) Q202L probably benign Het
Adgb C A 10: 10,318,246 (GRCm39) V199F probably damaging Het
Aff1 G T 5: 103,981,773 (GRCm39) R645S probably damaging Het
Aoc1 C T 6: 48,882,202 (GRCm39) S48F probably benign Het
Bpifb3 C G 2: 153,771,264 (GRCm39) S392C possibly damaging Het
Camk1d T C 2: 5,366,826 (GRCm39) M130V probably benign Het
Ces1a T A 8: 93,753,954 (GRCm39) N350Y probably damaging Het
Cfap57 G A 4: 118,457,091 (GRCm39) R453C probably damaging Het
Chd4 T A 6: 125,098,619 (GRCm39) N1532K probably damaging Het
Chd5 T C 4: 152,454,990 (GRCm39) L824P probably damaging Het
Ckap5 G A 2: 91,426,058 (GRCm39) R1306H probably damaging Het
Crybg1 A G 10: 43,873,670 (GRCm39) F1146S probably damaging Het
Dusp12 G A 1: 170,708,198 (GRCm39) T173M probably benign Het
Dync2h1 T C 9: 7,001,448 (GRCm39) T3854A probably benign Het
Echdc1 A T 10: 29,220,599 (GRCm39) I252F probably damaging Het
Emc1 A T 4: 139,086,684 (GRCm39) probably benign Het
Fbn2 C A 18: 58,172,377 (GRCm39) probably benign Het
Fsip2 T A 2: 82,814,933 (GRCm39) N3555K possibly damaging Het
Gabra1 T A 11: 42,070,403 (GRCm39) T20S probably benign Het
Igf1 A C 10: 87,697,236 (GRCm39) T2P possibly damaging Het
Insyn1 A T 9: 58,406,392 (GRCm39) M101L probably benign Het
Jcad C A 18: 4,675,730 (GRCm39) T1164N possibly damaging Het
Kalrn A T 16: 33,796,293 (GRCm39) S2830T probably damaging Het
Lepr C A 4: 101,590,620 (GRCm39) A66E possibly damaging Het
Lmntd1 T A 6: 145,359,206 (GRCm39) M315L probably benign Het
Lrch3 A G 16: 32,807,163 (GRCm39) T479A probably benign Het
Macroh2a1 T C 13: 56,244,052 (GRCm39) probably benign Het
Matr3 A G 18: 35,715,110 (GRCm39) N237D probably damaging Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Mtif2 A G 11: 29,490,683 (GRCm39) I462M probably benign Het
Nrip1 T C 16: 76,090,232 (GRCm39) I442V probably damaging Het
Or11g25 G A 14: 50,723,055 (GRCm39) A47T probably benign Het
Or6b2b T A 1: 92,419,124 (GRCm39) M118L possibly damaging Het
Or8k35 A T 2: 86,424,448 (GRCm39) C241* probably null Het
Otogl T A 10: 107,713,925 (GRCm39) Y498F probably damaging Het
Pbx3 A T 2: 34,066,832 (GRCm39) F351I probably benign Het
Pcdh18 T C 3: 49,710,854 (GRCm39) T154A probably benign Het
Pex5l A T 3: 33,005,025 (GRCm39) probably null Het
Plec T C 15: 76,072,432 (GRCm39) I718V probably benign Het
Pparg T A 6: 115,427,941 (GRCm39) Y143N probably damaging Het
Prl2c5 A G 13: 13,360,377 (GRCm39) I12V probably benign Het
Rcor3 T A 1: 191,804,411 (GRCm39) Q246L probably benign Het
Rnf214 A T 9: 45,780,746 (GRCm39) probably benign Het
S1pr5 A T 9: 21,155,425 (GRCm39) S334T probably benign Het
Scg3 C T 9: 75,589,449 (GRCm39) S35N possibly damaging Het
Septin5 A T 16: 18,443,960 (GRCm39) L19Q probably damaging Het
Serpinb7 T C 1: 107,356,025 (GRCm39) F16S probably damaging Het
Sipa1l3 A T 7: 29,038,551 (GRCm39) S365R probably damaging Het
Slc27a1 T C 8: 72,033,347 (GRCm39) probably null Het
Slc2a10 C A 2: 165,357,133 (GRCm39) H264Q probably benign Het
Slc9a3 A G 13: 74,309,889 (GRCm39) I526V probably benign Het
Smchd1 T C 17: 71,696,766 (GRCm39) D1203G probably damaging Het
Spata6l T C 19: 28,916,571 (GRCm39) probably null Het
Sult1b1 A G 5: 87,668,700 (GRCm39) W181R probably damaging Het
Supt6 A G 11: 78,110,703 (GRCm39) probably benign Het
Tcf12 C A 9: 71,775,497 (GRCm39) A418S probably damaging Het
Tesk1 C T 4: 43,443,576 (GRCm39) R48C probably damaging Het
Tiam2 A G 17: 3,487,510 (GRCm39) Q677R probably damaging Het
Tspan8 C T 10: 115,669,130 (GRCm39) A55V probably damaging Het
Txndc11 T C 16: 10,906,268 (GRCm39) N421D probably damaging Het
Vmn1r201 A G 13: 22,658,801 (GRCm39) N5S probably benign Het
Vmn2r120 T A 17: 57,832,826 (GRCm39) I118L probably benign Het
Vps13b A T 15: 35,675,105 (GRCm39) probably benign Het
Wdfy3 A G 5: 102,042,865 (GRCm39) V1962A probably damaging Het
Zswim8 C T 14: 20,760,815 (GRCm39) R107* probably null Het
Other mutations in Atf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Atf6 APN 1 170,616,175 (GRCm39) critical splice donor site probably null
IGL01431:Atf6 APN 1 170,680,571 (GRCm39) splice site probably benign
IGL01755:Atf6 APN 1 170,616,180 (GRCm39) missense possibly damaging 0.63
IGL02060:Atf6 APN 1 170,646,989 (GRCm39) missense probably damaging 0.99
IGL02416:Atf6 APN 1 170,574,726 (GRCm39) nonsense probably null
IGL02903:Atf6 APN 1 170,627,283 (GRCm39) missense probably benign 0.00
IGL02989:Atf6 APN 1 170,616,252 (GRCm39) splice site probably benign
IGL03209:Atf6 APN 1 170,662,463 (GRCm39) missense probably benign
R0455:Atf6 UTSW 1 170,662,492 (GRCm39) missense probably benign 0.00
R0467:Atf6 UTSW 1 170,621,589 (GRCm39) missense probably damaging 1.00
R0491:Atf6 UTSW 1 170,614,913 (GRCm39) critical splice donor site probably null
R0784:Atf6 UTSW 1 170,537,516 (GRCm39) missense probably benign 0.19
R1486:Atf6 UTSW 1 170,622,260 (GRCm39) missense probably damaging 1.00
R1945:Atf6 UTSW 1 170,682,710 (GRCm39) missense probably benign 0.00
R2164:Atf6 UTSW 1 170,622,304 (GRCm39) missense probably damaging 1.00
R3782:Atf6 UTSW 1 170,622,336 (GRCm39) nonsense probably null
R4454:Atf6 UTSW 1 170,621,608 (GRCm39) missense probably damaging 0.99
R4631:Atf6 UTSW 1 170,574,766 (GRCm39) splice site probably null
R4676:Atf6 UTSW 1 170,614,979 (GRCm39) missense probably damaging 1.00
R5772:Atf6 UTSW 1 170,574,758 (GRCm39) missense probably damaging 1.00
R5860:Atf6 UTSW 1 170,669,345 (GRCm39) missense possibly damaging 0.95
R5860:Atf6 UTSW 1 170,669,344 (GRCm39) missense probably damaging 1.00
R5950:Atf6 UTSW 1 170,662,448 (GRCm39) missense probably damaging 1.00
R6242:Atf6 UTSW 1 170,621,545 (GRCm39) missense possibly damaging 0.46
R6520:Atf6 UTSW 1 170,695,238 (GRCm39) missense probably benign 0.00
R7032:Atf6 UTSW 1 170,627,181 (GRCm39) critical splice donor site probably null
R7472:Atf6 UTSW 1 170,643,060 (GRCm39) missense possibly damaging 0.83
R7923:Atf6 UTSW 1 170,622,275 (GRCm39) missense probably benign
R8002:Atf6 UTSW 1 170,646,823 (GRCm39) missense probably benign 0.43
R8860:Atf6 UTSW 1 170,680,535 (GRCm39) missense probably null 0.95
R8956:Atf6 UTSW 1 170,621,576 (GRCm39) missense probably damaging 0.98
R9090:Atf6 UTSW 1 170,622,245 (GRCm39) missense probably damaging 1.00
R9271:Atf6 UTSW 1 170,622,245 (GRCm39) missense probably damaging 1.00
R9323:Atf6 UTSW 1 170,682,682 (GRCm39) nonsense probably null
R9500:Atf6 UTSW 1 170,574,708 (GRCm39) missense probably damaging 0.98
R9594:Atf6 UTSW 1 170,668,402 (GRCm39) missense probably benign 0.18
R9733:Atf6 UTSW 1 170,662,402 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAACATCTCCAAAGGGTCACTG -3'
(R):5'- TGGTACCATGATTCTGTGTGCC -3'

Sequencing Primer
(F):5'- ACATCTCCAAAGGGTCACTGTTATC -3'
(R):5'- GCCGTGTAACTTCTAGATCGCTG -3'
Posted On 2014-06-23