Mutagenetix > Incidental Mutations

Incidental Mutation 'R1850:Lepr'

207987

Institutional Source

Beutler Lab

Gene Symbol

Lepr

Ensembl Gene

ENSMUSG00000057722

Gene Name

leptin receptor

Synonyms

obl, Leprb, Obr, obese-like, OB-RGRP, Modb1, leptin receptor gene-related protein, LEPROT

MMRRC Submission

039874-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1850 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101717404-101815352 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 101733423 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 66 (A66E)

Ref Sequence

ENSEMBL: ENSMUSP00000102534 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037552] [ENSMUST00000102777] [ENSMUST00000106921] [ENSMUST00000145024]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037552
AA Change: A66E

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000037385
Gene: ENSMUSG00000057722
AA Change: A66E

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	328	418	6.3e-23	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC
low complexity region	908	921	N/A	INTRINSIC
low complexity region	1050	1065	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102777
AA Change: A66E

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000099838
Gene: ENSMUSG00000057722
AA Change: A66E

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	329	420	2.6e-29	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106921
AA Change: A66E

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000102534
Gene: ENSMUSG00000057722
AA Change: A66E

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	329	420	2.6e-29	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000145024

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.8%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4430402I18Rik	T	C	19: 28,939,171		probably null	Het
6030419C18Rik	A	T	9: 58,499,109	M101L	probably benign	Het
Adam28	T	A	14: 68,639,195	Q202L	probably benign	Het
Adgb	C	A	10: 10,442,502	V199F	probably damaging	Het
Aff1	G	T	5: 103,833,907	R645S	probably damaging	Het
Aoc1	C	T	6: 48,905,268	S48F	probably benign	Het
Atf6	A	T	1: 170,819,286	N339K	probably damaging	Het
Bpifb3	C	G	2: 153,929,344	S392C	possibly damaging	Het
Camk1d	T	C	2: 5,362,015	M130V	probably benign	Het
Ces1a	T	A	8: 93,027,326	N350Y	probably damaging	Het
Cfap57	G	A	4: 118,599,894	R453C	probably damaging	Het
Chd4	T	A	6: 125,121,656	N1532K	probably damaging	Het
Chd5	T	C	4: 152,370,533	L824P	probably damaging	Het
Ckap5	G	A	2: 91,595,713	R1306H	probably damaging	Het
Crybg1	A	G	10: 43,997,674	F1146S	probably damaging	Het
Dusp12	G	A	1: 170,880,629	T173M	probably benign	Het
Dync2h1	T	C	9: 7,001,448	T3854A	probably benign	Het
Echdc1	A	T	10: 29,344,603	I252F	probably damaging	Het
Emc1	A	T	4: 139,359,373		probably benign	Het
Fbn2	C	A	18: 58,039,305		probably benign	Het
Fsip2	T	A	2: 82,984,589	N3555K	possibly damaging	Het
Gabra1	T	A	11: 42,179,576	T20S	probably benign	Het
H2afy	T	C	13: 56,096,239		probably benign	Het
Igf1	A	C	10: 87,861,374	T2P	possibly damaging	Het
Jcad	C	A	18: 4,675,730	T1164N	possibly damaging	Het
Kalrn	A	T	16: 33,975,923	S2830T	probably damaging	Het
Lmntd1	T	A	6: 145,413,480	M315L	probably benign	Het
Lrch3	A	G	16: 32,986,793	T479A	probably benign	Het
Matr3	A	G	18: 35,582,057	N237D	probably damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Mtif2	A	G	11: 29,540,683	I462M	probably benign	Het
Nrip1	T	C	16: 76,293,344	I442V	probably damaging	Het
Olfr1082	A	T	2: 86,594,104	C241*	probably null	Het
Olfr1415	T	A	1: 92,491,402	M118L	possibly damaging	Het
Olfr741	G	A	14: 50,485,598	A47T	probably benign	Het
Otogl	T	A	10: 107,878,064	Y498F	probably damaging	Het
Pbx3	A	T	2: 34,176,820	F351I	probably benign	Het
Pcdh18	T	C	3: 49,756,405	T154A	probably benign	Het
Pex5l	A	T	3: 32,950,876		probably null	Het
Plec	T	C	15: 76,188,232	I718V	probably benign	Het
Pparg	T	A	6: 115,450,980	Y143N	probably damaging	Het
Prl2c5	A	G	13: 13,185,792	I12V	probably benign	Het
Rcor3	T	A	1: 192,120,111	Q246L	probably benign	Het
Rnf214	A	T	9: 45,869,448		probably benign	Het
S1pr5	A	T	9: 21,244,129	S334T	probably benign	Het
Scg3	C	T	9: 75,682,167	S35N	possibly damaging	Het
Sept5	A	T	16: 18,625,210	L19Q	probably damaging	Het
Serpinb7	T	C	1: 107,428,295	F16S	probably damaging	Het
Sipa1l3	A	T	7: 29,339,126	S365R	probably damaging	Het
Slc27a1	T	C	8: 71,580,703		probably null	Het
Slc2a10	C	A	2: 165,515,213	H264Q	probably benign	Het
Slc9a3	A	G	13: 74,161,770	I526V	probably benign	Het
Smchd1	T	C	17: 71,389,771	D1203G	probably damaging	Het
Sult1b1	A	G	5: 87,520,841	W181R	probably damaging	Het
Supt6	A	G	11: 78,219,877		probably benign	Het
Tcf12	C	A	9: 71,868,215	A418S	probably damaging	Het
Tesk1	C	T	4: 43,443,576	R48C	probably damaging	Het
Tiam2	A	G	17: 3,437,235	Q677R	probably damaging	Het
Tspan8	C	T	10: 115,833,225	A55V	probably damaging	Het
Txndc11	T	C	16: 11,088,404	N421D	probably damaging	Het
Vmn1r201	A	G	13: 22,474,631	N5S	probably benign	Het
Vmn2r120	T	A	17: 57,525,826	I118L	probably benign	Het
Vps13b	A	T	15: 35,674,959		probably benign	Het
Wdfy3	A	G	5: 101,894,999	V1962A	probably damaging	Het
Zswim8	C	T	14: 20,710,747	R107*	probably null	Het

Other mutations in Lepr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Lepr	APN	4	101815035	missense	probably benign
IGL01111:Lepr	APN	4	101814655	missense	possibly damaging	0.77
IGL01324:Lepr	APN	4	101768068	missense	probably benign	0.23
IGL01372:Lepr	APN	4	101735577	missense	possibly damaging	0.67
IGL01626:Lepr	APN	4	101733534	missense	probably benign	0.10
IGL01733:Lepr	APN	4	101765082	missense	probably benign	0.00
IGL01815:Lepr	APN	4	101814790	missense	possibly damaging	0.49
IGL01899:Lepr	APN	4	101779987	missense	possibly damaging	0.86
IGL02138:Lepr	APN	4	101768067	missense	probably damaging	0.98
IGL02161:Lepr	APN	4	101745678	missense	probably damaging	0.97
IGL02653:Lepr	APN	4	101764944	missense	probably benign	0.44
IGL02735:Lepr	APN	4	101782638	missense	probably damaging	1.00
IGL03035:Lepr	APN	4	101764980	missense	probably damaging	1.00
IGL03083:Lepr	APN	4	101814679	nonsense	probably null
IGL03160:Lepr	APN	4	101764906	missense	probably damaging	1.00
business_class	UTSW	4	101764872	missense	probably damaging	1.00
cherub	UTSW	4	101768063	missense	probably benign	0.25
clodhopper	UTSW	4	101765290	splice site	probably null
donner	UTSW	4	101815201	missense	probably damaging	1.00
fluffy	UTSW	4	101792023	missense	probably damaging	1.00
giant	UTSW	4	101765152	critical splice donor site	probably null
gordo	UTSW	4	101765305	missense	probably damaging	0.97
Immunoglutton	UTSW	4	101765301	splice site	probably benign
Jumbo_shrimp	UTSW	4	101764954	nonsense	probably null
odd	UTSW	4	101728075	splice site	probably benign
paleo	UTSW	4	101745645	missense	possibly damaging	0.94
well-upholstered	UTSW	4	101772959	synonymous	probably benign
worldly	UTSW	4	101768228	missense	possibly damaging	0.96
PIT4651001:Lepr	UTSW	4	101791997	missense	probably damaging	1.00
PIT4696001:Lepr	UTSW	4	101779983	missense	probably benign	0.10
R0140:Lepr	UTSW	4	101768067	missense	probably damaging	1.00
R0197:Lepr	UTSW	4	101752152	missense	possibly damaging	0.64
R0279:Lepr	UTSW	4	101750344	missense	probably benign	0.05
R0487:Lepr	UTSW	4	101768093	nonsense	probably null
R0498:Lepr	UTSW	4	101745692	missense	probably benign	0.01
R0506:Lepr	UTSW	4	101773010	splice site	probably benign
R0512:Lepr	UTSW	4	101792019	missense	probably damaging	1.00
R0512:Lepr	UTSW	4	101814704	missense	possibly damaging	0.87
R0726:Lepr	UTSW	4	101764934	missense	probably benign	0.01
R1054:Lepr	UTSW	4	101782596	missense	probably damaging	0.97
R1109:Lepr	UTSW	4	101771355	missense	probably damaging	1.00
R1398:Lepr	UTSW	4	101792019	missense	probably damaging	1.00
R1464:Lepr	UTSW	4	101735681	missense	probably benign	0.08
R1464:Lepr	UTSW	4	101735681	missense	probably benign	0.08
R1519:Lepr	UTSW	4	101789344	missense	probably damaging	0.97
R1602:Lepr	UTSW	4	101745645	missense	possibly damaging	0.94
R1830:Lepr	UTSW	4	101735677	missense	probably damaging	1.00
R1918:Lepr	UTSW	4	101772836	missense	probably benign	0.08
R1928:Lepr	UTSW	4	101782730	splice site	probably benign
R2099:Lepr	UTSW	4	101772988	missense	probably damaging	1.00
R2102:Lepr	UTSW	4	101772981	missense	possibly damaging	0.95
R2175:Lepr	UTSW	4	101765379	missense	probably benign	0.01
R2254:Lepr	UTSW	4	101815112	missense	probably benign	0.26
R2396:Lepr	UTSW	4	101733528	missense	probably benign	0.19
R2508:Lepr	UTSW	4	101790896	missense	probably damaging	0.98
R2571:Lepr	UTSW	4	101768172	missense	possibly damaging	0.96
R3790:Lepr	UTSW	4	101790914	splice site	probably benign
R3882:Lepr	UTSW	4	101815265	missense	probably damaging	1.00
R3933:Lepr	UTSW	4	101765301	splice site	probably benign
R4211:Lepr	UTSW	4	101733414	missense	probably benign	0.19
R4343:Lepr	UTSW	4	101765152	critical splice donor site	probably null
R4345:Lepr	UTSW	4	101765152	critical splice donor site	probably null
R4544:Lepr	UTSW	4	101768228	missense	possibly damaging	0.96
R4546:Lepr	UTSW	4	101814641	missense	probably benign	0.35
R4724:Lepr	UTSW	4	101765365	nonsense	probably null
R4797:Lepr	UTSW	4	101780047	missense	possibly damaging	0.90
R4860:Lepr	UTSW	4	101789337	missense	probably benign	0.14
R4860:Lepr	UTSW	4	101789337	missense	probably benign	0.14
R4929:Lepr	UTSW	4	101815117	missense	probably benign	0.00
R4939:Lepr	UTSW	4	101733438	missense	possibly damaging	0.78
R5377:Lepr	UTSW	4	101815019	missense	possibly damaging	0.71
R5520:Lepr	UTSW	4	101745537	missense	probably benign	0.00
R5966:Lepr	UTSW	4	101792127	intron	probably benign
R6092:Lepr	UTSW	4	101792023	missense	probably damaging	1.00
R6130:Lepr	UTSW	4	101765372	missense	probably damaging	0.99
R6168:Lepr	UTSW	4	101735592	missense	probably damaging	0.99
R6232:Lepr	UTSW	4	101814391	intron	probably null
R6380:Lepr	UTSW	4	101764954	nonsense	probably null
R6427:Lepr	UTSW	4	101774257	missense	possibly damaging	0.47
R6428:Lepr	UTSW	4	101780098	missense	probably damaging	1.00
R6641:Lepr	UTSW	4	101765305	missense	probably damaging	0.97
R6650:Lepr	UTSW	4	101815201	missense	probably damaging	1.00
R6859:Lepr	UTSW	4	101765290	splice site	probably null
R7023:Lepr	UTSW	4	101789287	missense	probably damaging	1.00
R7145:Lepr	UTSW	4	101752197	missense	probably benign	0.00
R7174:Lepr	UTSW	4	101750338	missense	probably benign	0.01
R7179:Lepr	UTSW	4	101745659	missense	probably benign	0.06
R7189:Lepr	UTSW	4	101814764	missense	probably benign	0.00
R7426:Lepr	UTSW	4	101745656	missense	probably benign	0.03
R7531:Lepr	UTSW	4	101752175	missense	probably damaging	1.00
R7620:Lepr	UTSW	4	101752073	missense	probably benign	0.41
R7804:Lepr	UTSW	4	101782586	missense	probably damaging	1.00
X0026:Lepr	UTSW	4	101733327	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- ATCTTCGTGACAATGATGGCTTG -3'
(R):5'- TGGGGCATAAAAGTACTTACCTAG -3'

Sequencing Primer
(F):5'- ACAATGATGGCTTGTTTTCTCTGTC -3'
(R):5'- AAAGTACTTACCTAGCTGGCG -3'

Posted On

2014-06-23