Mutagenetix > Incidental Mutation

Incidental Mutation 'R1850:Cfap57'

207988

Institutional Source

Beutler Lab

Gene Symbol

Cfap57

Ensembl Gene

ENSMUSG00000028730

Gene Name

cilia and flagella associated protein 57

Synonyms

Wdr65, 1110020C03Rik, C130004B06Rik, LOC384050

MMRRC Submission

039874-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1850 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118554551-118620777 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 118599894 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 453 (R453C)

Ref Sequence

ENSEMBL: ENSMUSP00000080592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]

AlphaFold

Q9D180

Predicted Effect

probably damaging
Transcript: ENSMUST00000071972
AA Change: R453C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: R453C

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000081921
AA Change: R453C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: R453C

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Meta Mutation Damage Score

0.6030

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.8%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4430402I18Rik	T	C	19: 28,939,171		probably null	Het
6030419C18Rik	A	T	9: 58,499,109	M101L	probably benign	Het
Adam28	T	A	14: 68,639,195	Q202L	probably benign	Het
Adgb	C	A	10: 10,442,502	V199F	probably damaging	Het
Aff1	G	T	5: 103,833,907	R645S	probably damaging	Het
Aoc1	C	T	6: 48,905,268	S48F	probably benign	Het
Atf6	A	T	1: 170,819,286	N339K	probably damaging	Het
Bpifb3	C	G	2: 153,929,344	S392C	possibly damaging	Het
Camk1d	T	C	2: 5,362,015	M130V	probably benign	Het
Ces1a	T	A	8: 93,027,326	N350Y	probably damaging	Het
Chd4	T	A	6: 125,121,656	N1532K	probably damaging	Het
Chd5	T	C	4: 152,370,533	L824P	probably damaging	Het
Ckap5	G	A	2: 91,595,713	R1306H	probably damaging	Het
Crybg1	A	G	10: 43,997,674	F1146S	probably damaging	Het
Dusp12	G	A	1: 170,880,629	T173M	probably benign	Het
Dync2h1	T	C	9: 7,001,448	T3854A	probably benign	Het
Echdc1	A	T	10: 29,344,603	I252F	probably damaging	Het
Emc1	A	T	4: 139,359,373		probably benign	Het
Fbn2	C	A	18: 58,039,305		probably benign	Het
Fsip2	T	A	2: 82,984,589	N3555K	possibly damaging	Het
Gabra1	T	A	11: 42,179,576	T20S	probably benign	Het
H2afy	T	C	13: 56,096,239		probably benign	Het
Igf1	A	C	10: 87,861,374	T2P	possibly damaging	Het
Jcad	C	A	18: 4,675,730	T1164N	possibly damaging	Het
Kalrn	A	T	16: 33,975,923	S2830T	probably damaging	Het
Lepr	C	A	4: 101,733,423	A66E	possibly damaging	Het
Lmntd1	T	A	6: 145,413,480	M315L	probably benign	Het
Lrch3	A	G	16: 32,986,793	T479A	probably benign	Het
Matr3	A	G	18: 35,582,057	N237D	probably damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Mtif2	A	G	11: 29,540,683	I462M	probably benign	Het
Nrip1	T	C	16: 76,293,344	I442V	probably damaging	Het
Olfr1082	A	T	2: 86,594,104	C241*	probably null	Het
Olfr1415	T	A	1: 92,491,402	M118L	possibly damaging	Het
Olfr741	G	A	14: 50,485,598	A47T	probably benign	Het
Otogl	T	A	10: 107,878,064	Y498F	probably damaging	Het
Pbx3	A	T	2: 34,176,820	F351I	probably benign	Het
Pcdh18	T	C	3: 49,756,405	T154A	probably benign	Het
Pex5l	A	T	3: 32,950,876		probably null	Het
Plec	T	C	15: 76,188,232	I718V	probably benign	Het
Pparg	T	A	6: 115,450,980	Y143N	probably damaging	Het
Prl2c5	A	G	13: 13,185,792	I12V	probably benign	Het
Rcor3	T	A	1: 192,120,111	Q246L	probably benign	Het
Rnf214	A	T	9: 45,869,448		probably benign	Het
S1pr5	A	T	9: 21,244,129	S334T	probably benign	Het
Scg3	C	T	9: 75,682,167	S35N	possibly damaging	Het
Sept5	A	T	16: 18,625,210	L19Q	probably damaging	Het
Serpinb7	T	C	1: 107,428,295	F16S	probably damaging	Het
Sipa1l3	A	T	7: 29,339,126	S365R	probably damaging	Het
Slc27a1	T	C	8: 71,580,703		probably null	Het
Slc2a10	C	A	2: 165,515,213	H264Q	probably benign	Het
Slc9a3	A	G	13: 74,161,770	I526V	probably benign	Het
Smchd1	T	C	17: 71,389,771	D1203G	probably damaging	Het
Sult1b1	A	G	5: 87,520,841	W181R	probably damaging	Het
Supt6	A	G	11: 78,219,877		probably benign	Het
Tcf12	C	A	9: 71,868,215	A418S	probably damaging	Het
Tesk1	C	T	4: 43,443,576	R48C	probably damaging	Het
Tiam2	A	G	17: 3,437,235	Q677R	probably damaging	Het
Tspan8	C	T	10: 115,833,225	A55V	probably damaging	Het
Txndc11	T	C	16: 11,088,404	N421D	probably damaging	Het
Vmn1r201	A	G	13: 22,474,631	N5S	probably benign	Het
Vmn2r120	T	A	17: 57,525,826	I118L	probably benign	Het
Vps13b	A	T	15: 35,674,959		probably benign	Het
Wdfy3	A	G	5: 101,894,999	V1962A	probably damaging	Het
Zswim8	C	T	14: 20,710,747	R107*	probably null	Het

Other mutations in Cfap57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Cfap57	APN	4	118581001	missense	probably benign	0.01
IGL00508:Cfap57	APN	4	118581170	splice site	probably null
IGL00857:Cfap57	APN	4	118612923	critical splice donor site	probably null
IGL01147:Cfap57	APN	4	118589001	missense	probably damaging	0.97
IGL01396:Cfap57	APN	4	118610595	missense	probably damaging	1.00
IGL01420:Cfap57	APN	4	118612940	missense	probably benign	0.21
IGL01615:Cfap57	APN	4	118600796	missense	probably damaging	1.00
IGL02154:Cfap57	APN	4	118613017	missense	probably damaging	1.00
IGL02161:Cfap57	APN	4	118579372	missense	possibly damaging	0.75
IGL02481:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02483:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02503:Cfap57	APN	4	118569348	critical splice donor site	probably null
IGL02800:Cfap57	APN	4	118614750	missense	probably damaging	1.00
IGL03083:Cfap57	APN	4	118584739	missense	probably damaging	0.96
IGL03146:Cfap57	APN	4	118599019	missense	probably damaging	1.00
IGL03246:Cfap57	APN	4	118576645	missense	probably benign	0.29
IGL03376:Cfap57	APN	4	118584720	missense	probably damaging	0.96
G1Funyon:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R0144:Cfap57	UTSW	4	118584705	missense	probably damaging	1.00
R0184:Cfap57	UTSW	4	118599012	missense	probably damaging	1.00
R0415:Cfap57	UTSW	4	118569431	missense	possibly damaging	0.89
R0515:Cfap57	UTSW	4	118620402	missense	probably damaging	1.00
R0690:Cfap57	UTSW	4	118569727	splice site	probably benign
R0730:Cfap57	UTSW	4	118612920	splice site	probably null
R0737:Cfap57	UTSW	4	118581102	missense	possibly damaging	0.81
R0854:Cfap57	UTSW	4	118561872	missense	probably benign	0.04
R0880:Cfap57	UTSW	4	118581838	nonsense	probably null
R1085:Cfap57	UTSW	4	118595779	missense	probably benign	0.20
R1119:Cfap57	UTSW	4	118606676	nonsense	probably null
R1217:Cfap57	UTSW	4	118606652	missense	possibly damaging	0.67
R1294:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R1487:Cfap57	UTSW	4	118614781	missense	probably benign	0.01
R1676:Cfap57	UTSW	4	118595940	missense	probably damaging	1.00
R1688:Cfap57	UTSW	4	118569646	missense	probably null	0.20
R1709:Cfap57	UTSW	4	118571704	missense	probably benign	0.00
R1719:Cfap57	UTSW	4	118606631	missense	probably benign	0.04
R1782:Cfap57	UTSW	4	118614975	missense	probably damaging	0.98
R1791:Cfap57	UTSW	4	118571724	missense	possibly damaging	0.66
R1866:Cfap57	UTSW	4	118599927	missense	possibly damaging	0.49
R1912:Cfap57	UTSW	4	118615010	missense	probably damaging	0.96
R1978:Cfap57	UTSW	4	118593132	missense	probably benign	0.03
R2177:Cfap57	UTSW	4	118606688	missense	probably benign	0.00
R2322:Cfap57	UTSW	4	118610725	missense	probably benign
R3905:Cfap57	UTSW	4	118595839	missense	probably damaging	1.00
R4013:Cfap57	UTSW	4	118593143	missense	probably benign	0.01
R4079:Cfap57	UTSW	4	118598997	missense	probably benign	0.34
R4962:Cfap57	UTSW	4	118613065	missense	probably benign	0.21
R4970:Cfap57	UTSW	4	118620371	missense	probably damaging	0.99
R4974:Cfap57	UTSW	4	118593054	missense	probably damaging	1.00
R4999:Cfap57	UTSW	4	118595848	missense	probably benign	0.01
R5482:Cfap57	UTSW	4	118569641	missense	probably benign
R5522:Cfap57	UTSW	4	118595888	missense	probably benign	0.41
R5626:Cfap57	UTSW	4	118614783	missense	probably damaging	1.00
R5685:Cfap57	UTSW	4	118569459	missense	probably benign
R5712:Cfap57	UTSW	4	118614795	missense	probably damaging	1.00
R5961:Cfap57	UTSW	4	118571745	missense	probably benign	0.00
R6244:Cfap57	UTSW	4	118579410	missense	probably damaging	0.99
R6268:Cfap57	UTSW	4	118569451	nonsense	probably null
R6271:Cfap57	UTSW	4	118595759	missense	probably benign	0.13
R6330:Cfap57	UTSW	4	118569396	missense	probably benign
R6439:Cfap57	UTSW	4	118588975	critical splice donor site	probably null
R6639:Cfap57	UTSW	4	118554712	missense	probably benign	0.13
R6722:Cfap57	UTSW	4	118584717	missense	probably damaging	1.00
R7033:Cfap57	UTSW	4	118613126	missense	possibly damaging	0.67
R7143:Cfap57	UTSW	4	118620709	unclassified	probably benign
R7162:Cfap57	UTSW	4	118614931	missense	probably benign
R7174:Cfap57	UTSW	4	118589067	missense	probably benign	0.35
R7210:Cfap57	UTSW	4	118576703	nonsense	probably null
R7242:Cfap57	UTSW	4	118593096	missense	possibly damaging	0.50
R7244:Cfap57	UTSW	4	118554800	nonsense	probably null
R7359:Cfap57	UTSW	4	118598965	missense	probably benign	0.01
R7373:Cfap57	UTSW	4	118614931	missense	probably benign
R7394:Cfap57	UTSW	4	118593137	missense	probably benign	0.00
R7401:Cfap57	UTSW	4	118614931	missense	probably benign
R7412:Cfap57	UTSW	4	118614931	missense	probably benign
R7414:Cfap57	UTSW	4	118614931	missense	probably benign
R7452:Cfap57	UTSW	4	118595784	missense	probably damaging	1.00
R7457:Cfap57	UTSW	4	118589001	missense	probably damaging	0.97
R7559:Cfap57	UTSW	4	118614931	missense	probably benign
R7642:Cfap57	UTSW	4	118614931	missense	probably benign
R7741:Cfap57	UTSW	4	118614931	missense	probably benign
R7744:Cfap57	UTSW	4	118614931	missense	probably benign
R7745:Cfap57	UTSW	4	118614931	missense	probably benign
R7842:Cfap57	UTSW	4	118554755	nonsense	probably null
R7936:Cfap57	UTSW	4	118614931	missense	probably benign
R7940:Cfap57	UTSW	4	118614931	missense	probably benign
R7942:Cfap57	UTSW	4	118614931	missense	probably benign
R8074:Cfap57	UTSW	4	118569625	missense	possibly damaging	0.66
R8301:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R8411:Cfap57	UTSW	4	118614931	missense	probably benign
R8447:Cfap57	UTSW	4	118614931	missense	probably benign
R8491:Cfap57	UTSW	4	118614931	missense	probably benign
R8524:Cfap57	UTSW	4	118614931	missense	probably benign
R8670:Cfap57	UTSW	4	118614925	missense	possibly damaging	0.91
R8707:Cfap57	UTSW	4	118593006	missense	probably benign	0.04
R8790:Cfap57	UTSW	4	118581914	missense	possibly damaging	0.59
R8941:Cfap57	UTSW	4	118569602	missense	probably damaging	0.99
R9139:Cfap57	UTSW	4	118554851	missense	probably benign	0.02
R9212:Cfap57	UTSW	4	118579452	missense	possibly damaging	0.95
R9442:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R9525:Cfap57	UTSW	4	118576581	missense	probably damaging	1.00
X0022:Cfap57	UTSW	4	118614745	missense	probably benign
Z1088:Cfap57	UTSW	4	118581882	missense	probably benign	0.22
Z1177:Cfap57	UTSW	4	118598956	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCAGAACCATGCACTGAGTG -3'
(R):5'- CCACCGTTATCTTTAACCAGAATC -3'

Sequencing Primer
(F):5'- ACCATGCACTGAGTGAGTCTG -3'
(R):5'- TCTTTAACCAGAATCCAGAAAACAG -3'

Posted On

2014-06-23