Incidental Mutation 'R1850:Cfap57'
ID207988
Institutional Source Beutler Lab
Gene Symbol Cfap57
Ensembl Gene ENSMUSG00000028730
Gene Namecilia and flagella associated protein 57
SynonymsWdr65, 1110020C03Rik, C130004B06Rik, LOC384050
MMRRC Submission 039874-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1850 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location118554551-118620777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118599894 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 453 (R453C)
Ref Sequence ENSEMBL: ENSMUSP00000080592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]
Predicted Effect probably damaging
Transcript: ENSMUST00000071972
AA Change: R453C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: R453C

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000081921
AA Change: R453C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: R453C

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Meta Mutation Damage Score 0.6030 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik T C 19: 28,939,171 probably null Het
6030419C18Rik A T 9: 58,499,109 M101L probably benign Het
Adam28 T A 14: 68,639,195 Q202L probably benign Het
Adgb C A 10: 10,442,502 V199F probably damaging Het
Aff1 G T 5: 103,833,907 R645S probably damaging Het
Aoc1 C T 6: 48,905,268 S48F probably benign Het
Atf6 A T 1: 170,819,286 N339K probably damaging Het
Bpifb3 C G 2: 153,929,344 S392C possibly damaging Het
Camk1d T C 2: 5,362,015 M130V probably benign Het
Ces1a T A 8: 93,027,326 N350Y probably damaging Het
Chd4 T A 6: 125,121,656 N1532K probably damaging Het
Chd5 T C 4: 152,370,533 L824P probably damaging Het
Ckap5 G A 2: 91,595,713 R1306H probably damaging Het
Crybg1 A G 10: 43,997,674 F1146S probably damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Dync2h1 T C 9: 7,001,448 T3854A probably benign Het
Echdc1 A T 10: 29,344,603 I252F probably damaging Het
Emc1 A T 4: 139,359,373 probably benign Het
Fbn2 C A 18: 58,039,305 probably benign Het
Fsip2 T A 2: 82,984,589 N3555K possibly damaging Het
Gabra1 T A 11: 42,179,576 T20S probably benign Het
H2afy T C 13: 56,096,239 probably benign Het
Igf1 A C 10: 87,861,374 T2P possibly damaging Het
Jcad C A 18: 4,675,730 T1164N possibly damaging Het
Kalrn A T 16: 33,975,923 S2830T probably damaging Het
Lepr C A 4: 101,733,423 A66E possibly damaging Het
Lmntd1 T A 6: 145,413,480 M315L probably benign Het
Lrch3 A G 16: 32,986,793 T479A probably benign Het
Matr3 A G 18: 35,582,057 N237D probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtif2 A G 11: 29,540,683 I462M probably benign Het
Nrip1 T C 16: 76,293,344 I442V probably damaging Het
Olfr1082 A T 2: 86,594,104 C241* probably null Het
Olfr1415 T A 1: 92,491,402 M118L possibly damaging Het
Olfr741 G A 14: 50,485,598 A47T probably benign Het
Otogl T A 10: 107,878,064 Y498F probably damaging Het
Pbx3 A T 2: 34,176,820 F351I probably benign Het
Pcdh18 T C 3: 49,756,405 T154A probably benign Het
Pex5l A T 3: 32,950,876 probably null Het
Plec T C 15: 76,188,232 I718V probably benign Het
Pparg T A 6: 115,450,980 Y143N probably damaging Het
Prl2c5 A G 13: 13,185,792 I12V probably benign Het
Rcor3 T A 1: 192,120,111 Q246L probably benign Het
Rnf214 A T 9: 45,869,448 probably benign Het
S1pr5 A T 9: 21,244,129 S334T probably benign Het
Scg3 C T 9: 75,682,167 S35N possibly damaging Het
Sept5 A T 16: 18,625,210 L19Q probably damaging Het
Serpinb7 T C 1: 107,428,295 F16S probably damaging Het
Sipa1l3 A T 7: 29,339,126 S365R probably damaging Het
Slc27a1 T C 8: 71,580,703 probably null Het
Slc2a10 C A 2: 165,515,213 H264Q probably benign Het
Slc9a3 A G 13: 74,161,770 I526V probably benign Het
Smchd1 T C 17: 71,389,771 D1203G probably damaging Het
Sult1b1 A G 5: 87,520,841 W181R probably damaging Het
Supt6 A G 11: 78,219,877 probably benign Het
Tcf12 C A 9: 71,868,215 A418S probably damaging Het
Tesk1 C T 4: 43,443,576 R48C probably damaging Het
Tiam2 A G 17: 3,437,235 Q677R probably damaging Het
Tspan8 C T 10: 115,833,225 A55V probably damaging Het
Txndc11 T C 16: 11,088,404 N421D probably damaging Het
Vmn1r201 A G 13: 22,474,631 N5S probably benign Het
Vmn2r120 T A 17: 57,525,826 I118L probably benign Het
Vps13b A T 15: 35,674,959 probably benign Het
Wdfy3 A G 5: 101,894,999 V1962A probably damaging Het
Zswim8 C T 14: 20,710,747 R107* probably null Het
Other mutations in Cfap57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Cfap57 APN 4 118581001 missense probably benign 0.01
IGL00508:Cfap57 APN 4 118581170 splice site probably null
IGL00857:Cfap57 APN 4 118612923 critical splice donor site probably null
IGL01147:Cfap57 APN 4 118589001 missense probably damaging 0.97
IGL01396:Cfap57 APN 4 118610595 missense probably damaging 1.00
IGL01420:Cfap57 APN 4 118612940 missense probably benign 0.21
IGL01615:Cfap57 APN 4 118600796 missense probably damaging 1.00
IGL02154:Cfap57 APN 4 118613017 missense probably damaging 1.00
IGL02161:Cfap57 APN 4 118579372 missense possibly damaging 0.75
IGL02481:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02483:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02503:Cfap57 APN 4 118569348 critical splice donor site probably null
IGL02800:Cfap57 APN 4 118614750 missense probably damaging 1.00
IGL03083:Cfap57 APN 4 118584739 missense probably damaging 0.96
IGL03146:Cfap57 APN 4 118599019 missense probably damaging 1.00
IGL03246:Cfap57 APN 4 118576645 missense probably benign 0.29
IGL03376:Cfap57 APN 4 118584720 missense probably damaging 0.96
R0144:Cfap57 UTSW 4 118584705 missense probably damaging 1.00
R0184:Cfap57 UTSW 4 118599012 missense probably damaging 1.00
R0415:Cfap57 UTSW 4 118569431 missense possibly damaging 0.89
R0515:Cfap57 UTSW 4 118620402 missense probably damaging 1.00
R0690:Cfap57 UTSW 4 118569727 splice site probably benign
R0730:Cfap57 UTSW 4 118612920 splice site probably null
R0737:Cfap57 UTSW 4 118581102 missense possibly damaging 0.81
R0854:Cfap57 UTSW 4 118561872 missense probably benign 0.04
R0880:Cfap57 UTSW 4 118581838 nonsense probably null
R1085:Cfap57 UTSW 4 118595779 missense probably benign 0.20
R1119:Cfap57 UTSW 4 118606676 nonsense probably null
R1217:Cfap57 UTSW 4 118606652 missense possibly damaging 0.67
R1294:Cfap57 UTSW 4 118606534 critical splice donor site probably null
R1487:Cfap57 UTSW 4 118614781 missense probably benign 0.01
R1676:Cfap57 UTSW 4 118595940 missense probably damaging 1.00
R1688:Cfap57 UTSW 4 118569646 missense probably null 0.20
R1709:Cfap57 UTSW 4 118571704 missense probably benign 0.00
R1719:Cfap57 UTSW 4 118606631 missense probably benign 0.04
R1782:Cfap57 UTSW 4 118614975 missense probably damaging 0.98
R1791:Cfap57 UTSW 4 118571724 missense possibly damaging 0.66
R1866:Cfap57 UTSW 4 118599927 missense possibly damaging 0.49
R1912:Cfap57 UTSW 4 118615010 missense probably damaging 0.96
R1978:Cfap57 UTSW 4 118593132 missense probably benign 0.03
R2177:Cfap57 UTSW 4 118606688 missense probably benign 0.00
R2322:Cfap57 UTSW 4 118610725 missense probably benign
R3905:Cfap57 UTSW 4 118595839 missense probably damaging 1.00
R4013:Cfap57 UTSW 4 118593143 missense probably benign 0.01
R4079:Cfap57 UTSW 4 118598997 missense probably benign 0.34
R4962:Cfap57 UTSW 4 118613065 missense probably benign 0.21
R4970:Cfap57 UTSW 4 118620371 missense probably damaging 0.99
R4974:Cfap57 UTSW 4 118593054 missense probably damaging 1.00
R4999:Cfap57 UTSW 4 118595848 missense probably benign 0.01
R5482:Cfap57 UTSW 4 118569641 missense probably benign
R5522:Cfap57 UTSW 4 118595888 missense probably benign 0.41
R5626:Cfap57 UTSW 4 118614783 missense probably damaging 1.00
R5685:Cfap57 UTSW 4 118569459 missense probably benign
R5712:Cfap57 UTSW 4 118614795 missense probably damaging 1.00
R5961:Cfap57 UTSW 4 118571745 missense probably benign 0.00
R6244:Cfap57 UTSW 4 118579410 missense probably damaging 0.99
R6268:Cfap57 UTSW 4 118569451 nonsense probably null
R6271:Cfap57 UTSW 4 118595759 missense probably benign 0.13
R6330:Cfap57 UTSW 4 118569396 missense probably benign
R6439:Cfap57 UTSW 4 118588975 critical splice donor site probably null
R6639:Cfap57 UTSW 4 118554712 missense probably benign 0.13
R6722:Cfap57 UTSW 4 118584717 missense probably damaging 1.00
R7033:Cfap57 UTSW 4 118613126 missense possibly damaging 0.67
R7143:Cfap57 UTSW 4 118620709 unclassified probably benign
R7162:Cfap57 UTSW 4 118614931 missense not run
R7174:Cfap57 UTSW 4 118589067 missense probably benign 0.35
R7210:Cfap57 UTSW 4 118576703 nonsense probably null
R7242:Cfap57 UTSW 4 118593096 missense possibly damaging 0.50
R7244:Cfap57 UTSW 4 118554800 nonsense probably null
R7359:Cfap57 UTSW 4 118598965 missense probably benign 0.01
R7373:Cfap57 UTSW 4 118614931 missense not run
R7394:Cfap57 UTSW 4 118593137 missense probably benign 0.00
R7401:Cfap57 UTSW 4 118614931 missense not run
R7412:Cfap57 UTSW 4 118614931 missense not run
R7414:Cfap57 UTSW 4 118614931 missense not run
R7452:Cfap57 UTSW 4 118595784 missense probably damaging 1.00
R7457:Cfap57 UTSW 4 118589001 missense probably damaging 0.97
R7559:Cfap57 UTSW 4 118614931 missense not run
R7642:Cfap57 UTSW 4 118614931 missense not run
R7741:Cfap57 UTSW 4 118614931 missense not run
R7744:Cfap57 UTSW 4 118614931 missense not run
R7745:Cfap57 UTSW 4 118614931 missense not run
R7842:Cfap57 UTSW 4 118554755 nonsense probably null
R7925:Cfap57 UTSW 4 118554755 nonsense probably null
R8074:Cfap57 UTSW 4 118569625 missense not run
X0022:Cfap57 UTSW 4 118614745 missense probably benign
Z1088:Cfap57 UTSW 4 118581882 missense probably benign 0.22
Z1177:Cfap57 UTSW 4 118598956 critical splice donor site unknown
Predicted Primers PCR Primer
(F):5'- GCAGAACCATGCACTGAGTG -3'
(R):5'- CCACCGTTATCTTTAACCAGAATC -3'

Sequencing Primer
(F):5'- ACCATGCACTGAGTGAGTCTG -3'
(R):5'- TCTTTAACCAGAATCCAGAAAACAG -3'
Posted On2014-06-23