Incidental Mutation 'R1850:Emc1'
ID207990
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene NameER membrane protein complex subunit 1
SynonymsC230096C10Rik
MMRRC Submission 039874-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R1850 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location139352587-139378730 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 139359373 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000147999] [ENSMUST00000155700] [ENSMUST00000179784]
Predicted Effect probably benign
Transcript: ENSMUST00000042096
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082262
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144335
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155700
Predicted Effect probably benign
Transcript: ENSMUST00000179784
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik T C 19: 28,939,171 probably null Het
6030419C18Rik A T 9: 58,499,109 M101L probably benign Het
Adam28 T A 14: 68,639,195 Q202L probably benign Het
Adgb C A 10: 10,442,502 V199F probably damaging Het
Aff1 G T 5: 103,833,907 R645S probably damaging Het
Aoc1 C T 6: 48,905,268 S48F probably benign Het
Atf6 A T 1: 170,819,286 N339K probably damaging Het
Bpifb3 C G 2: 153,929,344 S392C possibly damaging Het
Camk1d T C 2: 5,362,015 M130V probably benign Het
Ces1a T A 8: 93,027,326 N350Y probably damaging Het
Cfap57 G A 4: 118,599,894 R453C probably damaging Het
Chd4 T A 6: 125,121,656 N1532K probably damaging Het
Chd5 T C 4: 152,370,533 L824P probably damaging Het
Ckap5 G A 2: 91,595,713 R1306H probably damaging Het
Crybg1 A G 10: 43,997,674 F1146S probably damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Dync2h1 T C 9: 7,001,448 T3854A probably benign Het
Echdc1 A T 10: 29,344,603 I252F probably damaging Het
Fbn2 C A 18: 58,039,305 probably benign Het
Fsip2 T A 2: 82,984,589 N3555K possibly damaging Het
Gabra1 T A 11: 42,179,576 T20S probably benign Het
H2afy T C 13: 56,096,239 probably benign Het
Igf1 A C 10: 87,861,374 T2P possibly damaging Het
Jcad C A 18: 4,675,730 T1164N possibly damaging Het
Kalrn A T 16: 33,975,923 S2830T probably damaging Het
Lepr C A 4: 101,733,423 A66E possibly damaging Het
Lmntd1 T A 6: 145,413,480 M315L probably benign Het
Lrch3 A G 16: 32,986,793 T479A probably benign Het
Matr3 A G 18: 35,582,057 N237D probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtif2 A G 11: 29,540,683 I462M probably benign Het
Nrip1 T C 16: 76,293,344 I442V probably damaging Het
Olfr1082 A T 2: 86,594,104 C241* probably null Het
Olfr1415 T A 1: 92,491,402 M118L possibly damaging Het
Olfr741 G A 14: 50,485,598 A47T probably benign Het
Otogl T A 10: 107,878,064 Y498F probably damaging Het
Pbx3 A T 2: 34,176,820 F351I probably benign Het
Pcdh18 T C 3: 49,756,405 T154A probably benign Het
Pex5l A T 3: 32,950,876 probably null Het
Plec T C 15: 76,188,232 I718V probably benign Het
Pparg T A 6: 115,450,980 Y143N probably damaging Het
Prl2c5 A G 13: 13,185,792 I12V probably benign Het
Rcor3 T A 1: 192,120,111 Q246L probably benign Het
Rnf214 A T 9: 45,869,448 probably benign Het
S1pr5 A T 9: 21,244,129 S334T probably benign Het
Scg3 C T 9: 75,682,167 S35N possibly damaging Het
Sept5 A T 16: 18,625,210 L19Q probably damaging Het
Serpinb7 T C 1: 107,428,295 F16S probably damaging Het
Sipa1l3 A T 7: 29,339,126 S365R probably damaging Het
Slc27a1 T C 8: 71,580,703 probably null Het
Slc2a10 C A 2: 165,515,213 H264Q probably benign Het
Slc9a3 A G 13: 74,161,770 I526V probably benign Het
Smchd1 T C 17: 71,389,771 D1203G probably damaging Het
Sult1b1 A G 5: 87,520,841 W181R probably damaging Het
Supt6 A G 11: 78,219,877 probably benign Het
Tcf12 C A 9: 71,868,215 A418S probably damaging Het
Tesk1 C T 4: 43,443,576 R48C probably damaging Het
Tiam2 A G 17: 3,437,235 Q677R probably damaging Het
Tspan8 C T 10: 115,833,225 A55V probably damaging Het
Txndc11 T C 16: 11,088,404 N421D probably damaging Het
Vmn1r201 A G 13: 22,474,631 N5S probably benign Het
Vmn2r120 T A 17: 57,525,826 I118L probably benign Het
Vps13b A T 15: 35,674,959 probably benign Het
Wdfy3 A G 5: 101,894,999 V1962A probably damaging Het
Zswim8 C T 14: 20,710,747 R107* probably null Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139355082 splice site probably benign
IGL00898:Emc1 APN 4 139371630 missense probably damaging 1.00
IGL01481:Emc1 APN 4 139362099 missense probably benign 0.00
IGL02174:Emc1 APN 4 139371668 missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139375464 missense probably damaging 1.00
IGL02501:Emc1 APN 4 139370984 missense probably benign 0.00
IGL02697:Emc1 APN 4 139352644 missense probably benign
IGL03355:Emc1 APN 4 139371593 splice site probably benign
IGL03386:Emc1 APN 4 139363781 critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139359277 missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0051:Emc1 UTSW 4 139375163 missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139360485 missense probably damaging 0.99
R0613:Emc1 UTSW 4 139375072 splice site probably benign
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1512:Emc1 UTSW 4 139360184 splice site probably null
R1702:Emc1 UTSW 4 139375201 missense probably damaging 1.00
R1839:Emc1 UTSW 4 139360485 missense probably damaging 0.98
R1843:Emc1 UTSW 4 139375512 missense probably benign 0.02
R2024:Emc1 UTSW 4 139360946 missense possibly damaging 0.95
R2196:Emc1 UTSW 4 139366530 missense probably benign 0.08
R2912:Emc1 UTSW 4 139365260 missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139367163 missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139363185 nonsense probably null
R4738:Emc1 UTSW 4 139362202 missense possibly damaging 0.52
R4914:Emc1 UTSW 4 139375165 nonsense probably null
R5033:Emc1 UTSW 4 139371696 missense probably damaging 1.00
R5322:Emc1 UTSW 4 139354246 missense probably damaging 1.00
R5375:Emc1 UTSW 4 139366491 missense probably damaging 0.96
R5483:Emc1 UTSW 4 139375376 missense probably damaging 1.00
R5587:Emc1 UTSW 4 139362148 missense probably damaging 0.98
R5687:Emc1 UTSW 4 139375380 missense probably damaging 1.00
R5938:Emc1 UTSW 4 139357620 missense probably benign
R6056:Emc1 UTSW 4 139354222 missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139366378 missense probably benign 0.01
R6174:Emc1 UTSW 4 139366531 missense probably benign 0.01
R6208:Emc1 UTSW 4 139354271 missense probably damaging 0.99
R6340:Emc1 UTSW 4 139365563 missense probably damaging 1.00
R6371:Emc1 UTSW 4 139371665 nonsense probably null
R6889:Emc1 UTSW 4 139365350 missense probably damaging 0.97
R7592:Emc1 UTSW 4 139360566 missense probably benign 0.00
R7715:Emc1 UTSW 4 139371623 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGGGAAAGCTCAGGTCTAAGG -3'
(R):5'- TAGATCTGAGTCGCTCTTCTGC -3'

Sequencing Primer
(F):5'- AGCTCAGGTCTAAGGGCTCAG -3'
(R):5'- CCCGGAAGAGCACACTTTG -3'
Posted On2014-06-23