Incidental Mutation 'R1850:Vmn1r201'
ID208021
Institutional Source Beutler Lab
Gene Symbol Vmn1r201
Ensembl Gene ENSMUSG00000094898
Gene Namevomeronasal 1 receptor 201
SynonymsV1ri4
MMRRC Submission 039874-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R1850 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location22471923-22478701 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22474631 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 5 (N5S)
Ref Sequence ENSEMBL: ENSMUSP00000154790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091730] [ENSMUST00000226330] [ENSMUST00000226965]
Predicted Effect probably benign
Transcript: ENSMUST00000091730
AA Change: N5S

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000089324
Gene: ENSMUSG00000094898
AA Change: N5S

DomainStartEndE-ValueType
Pfam:TAS2R 1 293 2.4e-9 PFAM
Pfam:V1R 35 299 1.1e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226330
AA Change: N5S

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000226965
AA Change: N5S

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik T C 19: 28,939,171 probably null Het
6030419C18Rik A T 9: 58,499,109 M101L probably benign Het
Adam28 T A 14: 68,639,195 Q202L probably benign Het
Adgb C A 10: 10,442,502 V199F probably damaging Het
Aff1 G T 5: 103,833,907 R645S probably damaging Het
Aoc1 C T 6: 48,905,268 S48F probably benign Het
Atf6 A T 1: 170,819,286 N339K probably damaging Het
Bpifb3 C G 2: 153,929,344 S392C possibly damaging Het
Camk1d T C 2: 5,362,015 M130V probably benign Het
Ces1a T A 8: 93,027,326 N350Y probably damaging Het
Cfap57 G A 4: 118,599,894 R453C probably damaging Het
Chd4 T A 6: 125,121,656 N1532K probably damaging Het
Chd5 T C 4: 152,370,533 L824P probably damaging Het
Ckap5 G A 2: 91,595,713 R1306H probably damaging Het
Crybg1 A G 10: 43,997,674 F1146S probably damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Dync2h1 T C 9: 7,001,448 T3854A probably benign Het
Echdc1 A T 10: 29,344,603 I252F probably damaging Het
Emc1 A T 4: 139,359,373 probably benign Het
Fbn2 C A 18: 58,039,305 probably benign Het
Fsip2 T A 2: 82,984,589 N3555K possibly damaging Het
Gabra1 T A 11: 42,179,576 T20S probably benign Het
H2afy T C 13: 56,096,239 probably benign Het
Igf1 A C 10: 87,861,374 T2P possibly damaging Het
Jcad C A 18: 4,675,730 T1164N possibly damaging Het
Kalrn A T 16: 33,975,923 S2830T probably damaging Het
Lepr C A 4: 101,733,423 A66E possibly damaging Het
Lmntd1 T A 6: 145,413,480 M315L probably benign Het
Lrch3 A G 16: 32,986,793 T479A probably benign Het
Matr3 A G 18: 35,582,057 N237D probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtif2 A G 11: 29,540,683 I462M probably benign Het
Nrip1 T C 16: 76,293,344 I442V probably damaging Het
Olfr1082 A T 2: 86,594,104 C241* probably null Het
Olfr1415 T A 1: 92,491,402 M118L possibly damaging Het
Olfr741 G A 14: 50,485,598 A47T probably benign Het
Otogl T A 10: 107,878,064 Y498F probably damaging Het
Pbx3 A T 2: 34,176,820 F351I probably benign Het
Pcdh18 T C 3: 49,756,405 T154A probably benign Het
Pex5l A T 3: 32,950,876 probably null Het
Plec T C 15: 76,188,232 I718V probably benign Het
Pparg T A 6: 115,450,980 Y143N probably damaging Het
Prl2c5 A G 13: 13,185,792 I12V probably benign Het
Rcor3 T A 1: 192,120,111 Q246L probably benign Het
Rnf214 A T 9: 45,869,448 probably benign Het
S1pr5 A T 9: 21,244,129 S334T probably benign Het
Scg3 C T 9: 75,682,167 S35N possibly damaging Het
Sept5 A T 16: 18,625,210 L19Q probably damaging Het
Serpinb7 T C 1: 107,428,295 F16S probably damaging Het
Sipa1l3 A T 7: 29,339,126 S365R probably damaging Het
Slc27a1 T C 8: 71,580,703 probably null Het
Slc2a10 C A 2: 165,515,213 H264Q probably benign Het
Slc9a3 A G 13: 74,161,770 I526V probably benign Het
Smchd1 T C 17: 71,389,771 D1203G probably damaging Het
Sult1b1 A G 5: 87,520,841 W181R probably damaging Het
Supt6 A G 11: 78,219,877 probably benign Het
Tcf12 C A 9: 71,868,215 A418S probably damaging Het
Tesk1 C T 4: 43,443,576 R48C probably damaging Het
Tiam2 A G 17: 3,437,235 Q677R probably damaging Het
Tspan8 C T 10: 115,833,225 A55V probably damaging Het
Txndc11 T C 16: 11,088,404 N421D probably damaging Het
Vmn2r120 T A 17: 57,525,826 I118L probably benign Het
Vps13b A T 15: 35,674,959 probably benign Het
Wdfy3 A G 5: 101,894,999 V1962A probably damaging Het
Zswim8 C T 14: 20,710,747 R107* probably null Het
Other mutations in Vmn1r201
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02792:Vmn1r201 APN 13 22474844 missense probably damaging 0.97
IGL03137:Vmn1r201 APN 13 22474804 missense probably benign 0.01
R0278:Vmn1r201 UTSW 13 22475024 missense probably damaging 1.00
R0381:Vmn1r201 UTSW 13 22475023 missense probably damaging 1.00
R0544:Vmn1r201 UTSW 13 22475146 missense probably benign 0.04
R1411:Vmn1r201 UTSW 13 22474679 missense probably benign 0.01
R1544:Vmn1r201 UTSW 13 22474798 missense probably benign 0.20
R1891:Vmn1r201 UTSW 13 22475255 missense probably benign 0.01
R2071:Vmn1r201 UTSW 13 22474825 missense probably benign 0.34
R4183:Vmn1r201 UTSW 13 22474852 missense probably benign 0.01
R4924:Vmn1r201 UTSW 13 22474712 missense probably benign 0.00
R4989:Vmn1r201 UTSW 13 22475452 missense possibly damaging 0.95
R5028:Vmn1r201 UTSW 13 22475360 nonsense probably null
R5318:Vmn1r201 UTSW 13 22474922 missense probably damaging 1.00
R5369:Vmn1r201 UTSW 13 22475502 missense probably benign 0.00
R5682:Vmn1r201 UTSW 13 22475185 missense probably damaging 0.99
R5699:Vmn1r201 UTSW 13 22475239 missense probably damaging 1.00
R6180:Vmn1r201 UTSW 13 22475329 missense possibly damaging 0.94
R6273:Vmn1r201 UTSW 13 22475215 missense probably damaging 1.00
R6295:Vmn1r201 UTSW 13 22475363 missense probably benign 0.00
R6331:Vmn1r201 UTSW 13 22475351 missense probably damaging 1.00
R7296:Vmn1r201 UTSW 13 22475339 missense possibly damaging 0.69
R7758:Vmn1r201 UTSW 13 22474819 missense not run
R7832:Vmn1r201 UTSW 13 22475368 missense possibly damaging 0.76
R7887:Vmn1r201 UTSW 13 22474786 missense probably damaging 0.99
R7915:Vmn1r201 UTSW 13 22475368 missense possibly damaging 0.76
R7970:Vmn1r201 UTSW 13 22474786 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACTGTCGTCATTTCCATGG -3'
(R):5'- GATCCCTGTGCTACAAATAATGATC -3'

Sequencing Primer
(F):5'- ACTGTCGTCATTTCCATGGGAATAG -3'
(R):5'- TGATCAGATTAGAAAATGCCAAGTG -3'
Posted On2014-06-23