Incidental Mutation 'R1850:Slc9a3'
ID 208023
Institutional Source Beutler Lab
Gene Symbol Slc9a3
Ensembl Gene ENSMUSG00000036123
Gene Name solute carrier family 9 (sodium/hydrogen exchanger), member 3
Synonyms 9030624O13Rik, NHE-3, NHE3
MMRRC Submission 039874-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1850 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 74121457-74169442 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74161770 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 526 (I526V)
Ref Sequence ENSEMBL: ENSMUSP00000153255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036208] [ENSMUST00000221703] [ENSMUST00000225423]
AlphaFold G3X939
Predicted Effect probably benign
Transcript: ENSMUST00000036208
AA Change: I526V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000038142
Gene: ENSMUSG00000036123
AA Change: I526V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_H_Exchanger 53 457 3.6e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221703
AA Change: I526V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000225423
AA Change: I526V

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0948 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial brush border Na/H exchanger that uses an inward sodium ion gradient to expel acids from the cell. Defects in this gene are a cause of congenital secretory sodium diarrhea. Pseudogenes of this gene exist on chromosomes 10 and 22. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice have diarrhea associated with defects of renal and intestinal absorption. Males are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik T C 19: 28,939,171 probably null Het
6030419C18Rik A T 9: 58,499,109 M101L probably benign Het
Adam28 T A 14: 68,639,195 Q202L probably benign Het
Adgb C A 10: 10,442,502 V199F probably damaging Het
Aff1 G T 5: 103,833,907 R645S probably damaging Het
Aoc1 C T 6: 48,905,268 S48F probably benign Het
Atf6 A T 1: 170,819,286 N339K probably damaging Het
Bpifb3 C G 2: 153,929,344 S392C possibly damaging Het
Camk1d T C 2: 5,362,015 M130V probably benign Het
Ces1a T A 8: 93,027,326 N350Y probably damaging Het
Cfap57 G A 4: 118,599,894 R453C probably damaging Het
Chd4 T A 6: 125,121,656 N1532K probably damaging Het
Chd5 T C 4: 152,370,533 L824P probably damaging Het
Ckap5 G A 2: 91,595,713 R1306H probably damaging Het
Crybg1 A G 10: 43,997,674 F1146S probably damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Dync2h1 T C 9: 7,001,448 T3854A probably benign Het
Echdc1 A T 10: 29,344,603 I252F probably damaging Het
Emc1 A T 4: 139,359,373 probably benign Het
Fbn2 C A 18: 58,039,305 probably benign Het
Fsip2 T A 2: 82,984,589 N3555K possibly damaging Het
Gabra1 T A 11: 42,179,576 T20S probably benign Het
H2afy T C 13: 56,096,239 probably benign Het
Igf1 A C 10: 87,861,374 T2P possibly damaging Het
Jcad C A 18: 4,675,730 T1164N possibly damaging Het
Kalrn A T 16: 33,975,923 S2830T probably damaging Het
Lepr C A 4: 101,733,423 A66E possibly damaging Het
Lmntd1 T A 6: 145,413,480 M315L probably benign Het
Lrch3 A G 16: 32,986,793 T479A probably benign Het
Matr3 A G 18: 35,582,057 N237D probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtif2 A G 11: 29,540,683 I462M probably benign Het
Nrip1 T C 16: 76,293,344 I442V probably damaging Het
Olfr1082 A T 2: 86,594,104 C241* probably null Het
Olfr1415 T A 1: 92,491,402 M118L possibly damaging Het
Olfr741 G A 14: 50,485,598 A47T probably benign Het
Otogl T A 10: 107,878,064 Y498F probably damaging Het
Pbx3 A T 2: 34,176,820 F351I probably benign Het
Pcdh18 T C 3: 49,756,405 T154A probably benign Het
Pex5l A T 3: 32,950,876 probably null Het
Plec T C 15: 76,188,232 I718V probably benign Het
Pparg T A 6: 115,450,980 Y143N probably damaging Het
Prl2c5 A G 13: 13,185,792 I12V probably benign Het
Rcor3 T A 1: 192,120,111 Q246L probably benign Het
Rnf214 A T 9: 45,869,448 probably benign Het
S1pr5 A T 9: 21,244,129 S334T probably benign Het
Scg3 C T 9: 75,682,167 S35N possibly damaging Het
Sept5 A T 16: 18,625,210 L19Q probably damaging Het
Serpinb7 T C 1: 107,428,295 F16S probably damaging Het
Sipa1l3 A T 7: 29,339,126 S365R probably damaging Het
Slc27a1 T C 8: 71,580,703 probably null Het
Slc2a10 C A 2: 165,515,213 H264Q probably benign Het
Smchd1 T C 17: 71,389,771 D1203G probably damaging Het
Sult1b1 A G 5: 87,520,841 W181R probably damaging Het
Supt6 A G 11: 78,219,877 probably benign Het
Tcf12 C A 9: 71,868,215 A418S probably damaging Het
Tesk1 C T 4: 43,443,576 R48C probably damaging Het
Tiam2 A G 17: 3,437,235 Q677R probably damaging Het
Tspan8 C T 10: 115,833,225 A55V probably damaging Het
Txndc11 T C 16: 11,088,404 N421D probably damaging Het
Vmn1r201 A G 13: 22,474,631 N5S probably benign Het
Vmn2r120 T A 17: 57,525,826 I118L probably benign Het
Vps13b A T 15: 35,674,959 probably benign Het
Wdfy3 A G 5: 101,894,999 V1962A probably damaging Het
Zswim8 C T 14: 20,710,747 R107* probably null Het
Other mutations in Slc9a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Slc9a3 APN 13 74160302 missense probably benign 0.19
IGL01299:Slc9a3 APN 13 74160263 missense probably benign 0.33
IGL01390:Slc9a3 APN 13 74150761 missense probably benign 0.01
IGL01814:Slc9a3 APN 13 74165972 missense probably damaging 0.96
IGL02020:Slc9a3 APN 13 74158848 missense probably damaging 0.99
IGL02072:Slc9a3 APN 13 74165859 missense probably benign 0.00
IGL02186:Slc9a3 APN 13 74163114 missense possibly damaging 0.94
IGL02878:Slc9a3 APN 13 74165357 nonsense probably null
IGL03056:Slc9a3 APN 13 74150819 missense probably damaging 1.00
R0090:Slc9a3 UTSW 13 74158728 missense probably damaging 0.99
R0280:Slc9a3 UTSW 13 74159424 missense probably damaging 1.00
R0359:Slc9a3 UTSW 13 74157607 missense probably damaging 1.00
R0388:Slc9a3 UTSW 13 74121536 missense unknown
R0396:Slc9a3 UTSW 13 74157784 critical splice donor site probably null
R0893:Slc9a3 UTSW 13 74159246 missense probably damaging 1.00
R1169:Slc9a3 UTSW 13 74150743 missense probably damaging 0.98
R1640:Slc9a3 UTSW 13 74158818 missense probably damaging 1.00
R1769:Slc9a3 UTSW 13 74163071 missense probably benign 0.00
R1937:Slc9a3 UTSW 13 74166056 splice site probably null
R2048:Slc9a3 UTSW 13 74163741 missense probably damaging 1.00
R2146:Slc9a3 UTSW 13 74121603 missense probably benign 0.00
R2495:Slc9a3 UTSW 13 74158703 missense probably damaging 0.99
R2883:Slc9a3 UTSW 13 74158760 missense probably damaging 1.00
R2938:Slc9a3 UTSW 13 74121669 missense possibly damaging 0.62
R4538:Slc9a3 UTSW 13 74161732 missense possibly damaging 0.56
R4580:Slc9a3 UTSW 13 74158886 nonsense probably null
R4581:Slc9a3 UTSW 13 74164165 missense probably damaging 0.99
R4841:Slc9a3 UTSW 13 74165837 missense probably damaging 1.00
R4928:Slc9a3 UTSW 13 74157719 missense probably damaging 1.00
R4965:Slc9a3 UTSW 13 74164293 missense possibly damaging 0.62
R5079:Slc9a3 UTSW 13 74164287 missense probably damaging 0.97
R5329:Slc9a3 UTSW 13 74150960 missense possibly damaging 0.94
R5663:Slc9a3 UTSW 13 74163712 missense probably damaging 0.98
R5876:Slc9a3 UTSW 13 74161723 missense probably damaging 1.00
R5919:Slc9a3 UTSW 13 74158740 missense probably damaging 0.98
R6060:Slc9a3 UTSW 13 74150885 missense probably damaging 1.00
R6562:Slc9a3 UTSW 13 74155161 missense probably damaging 1.00
R6645:Slc9a3 UTSW 13 74164172 missense probably damaging 0.99
R7145:Slc9a3 UTSW 13 74150678 missense probably damaging 0.99
R7422:Slc9a3 UTSW 13 74150885 missense probably damaging 1.00
R7565:Slc9a3 UTSW 13 74157694 missense probably damaging 1.00
R7679:Slc9a3 UTSW 13 74160276 missense possibly damaging 0.88
R8032:Slc9a3 UTSW 13 74157644 missense probably damaging 1.00
R8080:Slc9a3 UTSW 13 74166027 missense probably benign 0.30
R8158:Slc9a3 UTSW 13 74155122 missense probably damaging 1.00
R8159:Slc9a3 UTSW 13 74164288 missense probably benign 0.01
R8837:Slc9a3 UTSW 13 74157704 missense probably damaging 1.00
R8939:Slc9a3 UTSW 13 74163776 missense possibly damaging 0.93
R9111:Slc9a3 UTSW 13 74150801 missense probably damaging 1.00
R9741:Slc9a3 UTSW 13 74158875 missense possibly damaging 0.95
Z1176:Slc9a3 UTSW 13 74165856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGTTGACTAGCTCTGGCAG -3'
(R):5'- GCCCTATTCCTAGAGTACAACTC -3'

Sequencing Primer
(F):5'- ACTAGCTCTGGCAGGCACTTG -3'
(R):5'- CAAGAACATTTGTGGTGAGCC -3'
Posted On 2014-06-23