Incidental Mutation 'R1850:Vps13b'
ID 208028
Institutional Source Beutler Lab
Gene Symbol Vps13b
Ensembl Gene ENSMUSG00000037646
Gene Name vacuolar protein sorting 13B
Synonyms 1810042B05Rik, C330002D13Rik, 2310042E16Rik, Coh1
MMRRC Submission 039874-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1850 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 35371306-35931375 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 35675105 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048646]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000048646
SMART Domains Protein: ENSMUSP00000045490
Gene: ENSMUSG00000037646

DomainStartEndE-ValueType
Pfam:Chorein_N 2 120 1e-29 PFAM
low complexity region 128 137 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1007 1018 N/A INTRINSIC
low complexity region 1876 1883 N/A INTRINSIC
low complexity region 2042 2054 N/A INTRINSIC
low complexity region 2414 2423 N/A INTRINSIC
Pfam:SHR-BD 2601 2700 8.4e-10 PFAM
low complexity region 2954 2964 N/A INTRINSIC
Pfam:VPS13_C 3539 3706 2.6e-30 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam28 T A 14: 68,876,644 (GRCm39) Q202L probably benign Het
Adgb C A 10: 10,318,246 (GRCm39) V199F probably damaging Het
Aff1 G T 5: 103,981,773 (GRCm39) R645S probably damaging Het
Aoc1 C T 6: 48,882,202 (GRCm39) S48F probably benign Het
Atf6 A T 1: 170,646,855 (GRCm39) N339K probably damaging Het
Bpifb3 C G 2: 153,771,264 (GRCm39) S392C possibly damaging Het
Camk1d T C 2: 5,366,826 (GRCm39) M130V probably benign Het
Ces1a T A 8: 93,753,954 (GRCm39) N350Y probably damaging Het
Cfap57 G A 4: 118,457,091 (GRCm39) R453C probably damaging Het
Chd4 T A 6: 125,098,619 (GRCm39) N1532K probably damaging Het
Chd5 T C 4: 152,454,990 (GRCm39) L824P probably damaging Het
Ckap5 G A 2: 91,426,058 (GRCm39) R1306H probably damaging Het
Crybg1 A G 10: 43,873,670 (GRCm39) F1146S probably damaging Het
Dusp12 G A 1: 170,708,198 (GRCm39) T173M probably benign Het
Dync2h1 T C 9: 7,001,448 (GRCm39) T3854A probably benign Het
Echdc1 A T 10: 29,220,599 (GRCm39) I252F probably damaging Het
Emc1 A T 4: 139,086,684 (GRCm39) probably benign Het
Fbn2 C A 18: 58,172,377 (GRCm39) probably benign Het
Fsip2 T A 2: 82,814,933 (GRCm39) N3555K possibly damaging Het
Gabra1 T A 11: 42,070,403 (GRCm39) T20S probably benign Het
Igf1 A C 10: 87,697,236 (GRCm39) T2P possibly damaging Het
Insyn1 A T 9: 58,406,392 (GRCm39) M101L probably benign Het
Jcad C A 18: 4,675,730 (GRCm39) T1164N possibly damaging Het
Kalrn A T 16: 33,796,293 (GRCm39) S2830T probably damaging Het
Lepr C A 4: 101,590,620 (GRCm39) A66E possibly damaging Het
Lmntd1 T A 6: 145,359,206 (GRCm39) M315L probably benign Het
Lrch3 A G 16: 32,807,163 (GRCm39) T479A probably benign Het
Macroh2a1 T C 13: 56,244,052 (GRCm39) probably benign Het
Matr3 A G 18: 35,715,110 (GRCm39) N237D probably damaging Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Mtif2 A G 11: 29,490,683 (GRCm39) I462M probably benign Het
Nrip1 T C 16: 76,090,232 (GRCm39) I442V probably damaging Het
Or11g25 G A 14: 50,723,055 (GRCm39) A47T probably benign Het
Or6b2b T A 1: 92,419,124 (GRCm39) M118L possibly damaging Het
Or8k35 A T 2: 86,424,448 (GRCm39) C241* probably null Het
Otogl T A 10: 107,713,925 (GRCm39) Y498F probably damaging Het
Pbx3 A T 2: 34,066,832 (GRCm39) F351I probably benign Het
Pcdh18 T C 3: 49,710,854 (GRCm39) T154A probably benign Het
Pex5l A T 3: 33,005,025 (GRCm39) probably null Het
Plec T C 15: 76,072,432 (GRCm39) I718V probably benign Het
Pparg T A 6: 115,427,941 (GRCm39) Y143N probably damaging Het
Prl2c5 A G 13: 13,360,377 (GRCm39) I12V probably benign Het
Rcor3 T A 1: 191,804,411 (GRCm39) Q246L probably benign Het
Rnf214 A T 9: 45,780,746 (GRCm39) probably benign Het
S1pr5 A T 9: 21,155,425 (GRCm39) S334T probably benign Het
Scg3 C T 9: 75,589,449 (GRCm39) S35N possibly damaging Het
Septin5 A T 16: 18,443,960 (GRCm39) L19Q probably damaging Het
Serpinb7 T C 1: 107,356,025 (GRCm39) F16S probably damaging Het
Sipa1l3 A T 7: 29,038,551 (GRCm39) S365R probably damaging Het
Slc27a1 T C 8: 72,033,347 (GRCm39) probably null Het
Slc2a10 C A 2: 165,357,133 (GRCm39) H264Q probably benign Het
Slc9a3 A G 13: 74,309,889 (GRCm39) I526V probably benign Het
Smchd1 T C 17: 71,696,766 (GRCm39) D1203G probably damaging Het
Spata6l T C 19: 28,916,571 (GRCm39) probably null Het
Sult1b1 A G 5: 87,668,700 (GRCm39) W181R probably damaging Het
Supt6 A G 11: 78,110,703 (GRCm39) probably benign Het
Tcf12 C A 9: 71,775,497 (GRCm39) A418S probably damaging Het
Tesk1 C T 4: 43,443,576 (GRCm39) R48C probably damaging Het
Tiam2 A G 17: 3,487,510 (GRCm39) Q677R probably damaging Het
Tspan8 C T 10: 115,669,130 (GRCm39) A55V probably damaging Het
Txndc11 T C 16: 10,906,268 (GRCm39) N421D probably damaging Het
Vmn1r201 A G 13: 22,658,801 (GRCm39) N5S probably benign Het
Vmn2r120 T A 17: 57,832,826 (GRCm39) I118L probably benign Het
Wdfy3 A G 5: 102,042,865 (GRCm39) V1962A probably damaging Het
Zswim8 C T 14: 20,760,815 (GRCm39) R107* probably null Het
Other mutations in Vps13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Vps13b APN 15 35,926,372 (GRCm39) missense possibly damaging 0.52
IGL00513:Vps13b APN 15 35,794,030 (GRCm39) missense probably damaging 1.00
IGL00516:Vps13b APN 15 35,640,703 (GRCm39) missense probably damaging 1.00
IGL00640:Vps13b APN 15 35,417,723 (GRCm39) missense probably benign
IGL00753:Vps13b APN 15 35,372,177 (GRCm39) missense probably damaging 0.99
IGL00784:Vps13b APN 15 35,847,046 (GRCm39) missense probably damaging 1.00
IGL01138:Vps13b APN 15 35,446,916 (GRCm39) splice site probably benign
IGL01349:Vps13b APN 15 35,794,091 (GRCm39) missense probably benign 0.00
IGL01403:Vps13b APN 15 35,709,625 (GRCm39) missense probably benign 0.00
IGL01535:Vps13b APN 15 35,455,103 (GRCm39) missense possibly damaging 0.67
IGL01571:Vps13b APN 15 35,877,635 (GRCm39) splice site probably benign
IGL01642:Vps13b APN 15 35,792,218 (GRCm39) missense probably benign 0.43
IGL01658:Vps13b APN 15 35,671,479 (GRCm39) missense probably damaging 0.99
IGL01759:Vps13b APN 15 35,878,935 (GRCm39) missense probably damaging 1.00
IGL01763:Vps13b APN 15 35,709,945 (GRCm39) missense possibly damaging 0.72
IGL01906:Vps13b APN 15 35,639,993 (GRCm39) splice site probably benign
IGL01982:Vps13b APN 15 35,439,050 (GRCm39) nonsense probably null
IGL01997:Vps13b APN 15 35,709,370 (GRCm39) missense probably damaging 1.00
IGL02041:Vps13b APN 15 35,423,391 (GRCm39) missense probably damaging 0.98
IGL02073:Vps13b APN 15 35,875,732 (GRCm39) missense possibly damaging 0.52
IGL02077:Vps13b APN 15 35,910,759 (GRCm39) missense possibly damaging 0.68
IGL02141:Vps13b APN 15 35,572,227 (GRCm39) missense probably benign 0.09
IGL02146:Vps13b APN 15 35,646,479 (GRCm39) missense probably benign 0.36
IGL02197:Vps13b APN 15 35,930,202 (GRCm39) missense probably benign 0.02
IGL02311:Vps13b APN 15 35,709,660 (GRCm39) missense probably benign 0.08
IGL02466:Vps13b APN 15 35,770,887 (GRCm39) missense possibly damaging 0.86
IGL02506:Vps13b APN 15 35,917,308 (GRCm39) missense probably damaging 1.00
IGL02550:Vps13b APN 15 35,572,242 (GRCm39) missense probably benign
IGL02553:Vps13b APN 15 35,646,447 (GRCm39) missense probably benign 0.00
IGL02674:Vps13b APN 15 35,640,104 (GRCm39) missense probably benign 0.41
IGL02690:Vps13b APN 15 35,917,288 (GRCm39) missense probably damaging 1.00
IGL02731:Vps13b APN 15 35,917,274 (GRCm39) missense probably benign 0.00
IGL02739:Vps13b APN 15 35,880,046 (GRCm39) missense probably damaging 1.00
IGL02868:Vps13b APN 15 35,884,665 (GRCm39) missense probably benign 0.03
IGL03081:Vps13b APN 15 35,875,966 (GRCm39) missense probably damaging 0.97
IGL03178:Vps13b APN 15 35,869,446 (GRCm39) missense probably damaging 1.00
IGL03343:Vps13b APN 15 35,917,316 (GRCm39) missense possibly damaging 0.76
IGL03407:Vps13b APN 15 35,640,012 (GRCm39) missense possibly damaging 0.95
IGL03410:Vps13b APN 15 35,910,486 (GRCm39) missense probably benign
omlette UTSW 15 35,671,546 (GRCm39) missense probably benign 0.13
swiss UTSW 15 35,709,819 (GRCm39) missense possibly damaging 0.80
FR4449:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
FR4548:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
FR4737:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
FR4976:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
LCD18:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
PIT4531001:Vps13b UTSW 15 35,878,971 (GRCm39) missense probably damaging 1.00
PIT4581001:Vps13b UTSW 15 35,534,409 (GRCm39) missense probably damaging 1.00
PIT4618001:Vps13b UTSW 15 35,709,386 (GRCm39) missense probably damaging 1.00
R0026:Vps13b UTSW 15 35,923,447 (GRCm39) missense possibly damaging 0.62
R0026:Vps13b UTSW 15 35,923,447 (GRCm39) missense possibly damaging 0.62
R0108:Vps13b UTSW 15 35,572,265 (GRCm39) missense probably benign 0.20
R0109:Vps13b UTSW 15 35,572,265 (GRCm39) missense probably benign 0.20
R0109:Vps13b UTSW 15 35,572,265 (GRCm39) missense probably benign 0.20
R0116:Vps13b UTSW 15 35,423,301 (GRCm39) missense probably damaging 0.99
R0123:Vps13b UTSW 15 35,887,407 (GRCm39) missense probably benign 0.01
R0124:Vps13b UTSW 15 35,576,674 (GRCm39) critical splice donor site probably null
R0134:Vps13b UTSW 15 35,887,407 (GRCm39) missense probably benign 0.01
R0137:Vps13b UTSW 15 35,926,365 (GRCm39) missense probably benign 0.06
R0195:Vps13b UTSW 15 35,472,045 (GRCm39) missense probably benign 0.00
R0225:Vps13b UTSW 15 35,887,407 (GRCm39) missense probably benign 0.01
R0320:Vps13b UTSW 15 35,674,974 (GRCm39) missense probably damaging 0.98
R0333:Vps13b UTSW 15 35,879,949 (GRCm39) missense probably damaging 1.00
R0336:Vps13b UTSW 15 35,455,279 (GRCm39) nonsense probably null
R0463:Vps13b UTSW 15 35,597,555 (GRCm39) missense probably damaging 0.98
R0466:Vps13b UTSW 15 35,445,748 (GRCm39) nonsense probably null
R0472:Vps13b UTSW 15 35,417,779 (GRCm39) critical splice donor site probably null
R0523:Vps13b UTSW 15 35,472,196 (GRCm39) missense probably benign 0.20
R0602:Vps13b UTSW 15 35,422,514 (GRCm39) missense probably damaging 1.00
R0612:Vps13b UTSW 15 35,623,803 (GRCm39) missense probably benign 0.12
R0627:Vps13b UTSW 15 35,372,145 (GRCm39) nonsense probably null
R0679:Vps13b UTSW 15 35,709,849 (GRCm39) missense possibly damaging 0.73
R0742:Vps13b UTSW 15 35,794,507 (GRCm39) missense probably benign 0.22
R1053:Vps13b UTSW 15 35,652,509 (GRCm39) missense probably damaging 1.00
R1355:Vps13b UTSW 15 35,422,600 (GRCm39) missense probably damaging 1.00
R1386:Vps13b UTSW 15 35,923,458 (GRCm39) missense probably damaging 0.99
R1403:Vps13b UTSW 15 35,709,268 (GRCm39) splice site probably benign
R1453:Vps13b UTSW 15 35,422,590 (GRCm39) missense probably damaging 0.97
R1464:Vps13b UTSW 15 35,709,630 (GRCm39) missense probably benign 0.14
R1464:Vps13b UTSW 15 35,709,630 (GRCm39) missense probably benign 0.14
R1511:Vps13b UTSW 15 35,841,719 (GRCm39) missense probably benign 0.00
R1511:Vps13b UTSW 15 35,840,121 (GRCm39) missense probably damaging 0.99
R1513:Vps13b UTSW 15 35,438,876 (GRCm39) nonsense probably null
R1536:Vps13b UTSW 15 35,875,712 (GRCm39) missense probably damaging 0.98
R1537:Vps13b UTSW 15 35,792,327 (GRCm39) missense possibly damaging 0.62
R1558:Vps13b UTSW 15 35,534,465 (GRCm39) missense probably damaging 1.00
R1601:Vps13b UTSW 15 35,642,582 (GRCm39) missense probably benign 0.11
R1653:Vps13b UTSW 15 35,607,418 (GRCm39) nonsense probably null
R1695:Vps13b UTSW 15 35,576,667 (GRCm39) missense probably benign 0.05
R1760:Vps13b UTSW 15 35,884,765 (GRCm39) missense possibly damaging 0.54
R1785:Vps13b UTSW 15 35,879,937 (GRCm39) missense probably damaging 1.00
R1786:Vps13b UTSW 15 35,879,937 (GRCm39) missense probably damaging 1.00
R1803:Vps13b UTSW 15 35,430,351 (GRCm39) nonsense probably null
R1804:Vps13b UTSW 15 35,917,283 (GRCm39) missense probably damaging 1.00
R1808:Vps13b UTSW 15 35,792,205 (GRCm39) missense probably benign 0.00
R1817:Vps13b UTSW 15 35,910,788 (GRCm39) missense possibly damaging 0.86
R1818:Vps13b UTSW 15 35,877,723 (GRCm39) missense probably benign 0.00
R1836:Vps13b UTSW 15 35,910,378 (GRCm39) missense probably damaging 0.99
R1884:Vps13b UTSW 15 35,430,437 (GRCm39) splice site probably benign
R1938:Vps13b UTSW 15 35,709,653 (GRCm39) missense probably damaging 1.00
R1955:Vps13b UTSW 15 35,925,554 (GRCm39) critical splice donor site probably null
R1956:Vps13b UTSW 15 35,869,553 (GRCm39) missense probably damaging 1.00
R1958:Vps13b UTSW 15 35,878,835 (GRCm39) missense probably damaging 0.99
R2013:Vps13b UTSW 15 35,607,288 (GRCm39) missense probably damaging 0.99
R2014:Vps13b UTSW 15 35,607,288 (GRCm39) missense probably damaging 0.99
R2015:Vps13b UTSW 15 35,607,288 (GRCm39) missense probably damaging 0.99
R2038:Vps13b UTSW 15 35,884,887 (GRCm39) missense probably damaging 1.00
R2058:Vps13b UTSW 15 35,841,593 (GRCm39) missense probably damaging 1.00
R2082:Vps13b UTSW 15 35,910,892 (GRCm39) missense possibly damaging 0.70
R2087:Vps13b UTSW 15 35,597,639 (GRCm39) missense probably damaging 0.99
R2124:Vps13b UTSW 15 35,646,226 (GRCm39) missense probably benign 0.08
R2130:Vps13b UTSW 15 35,671,546 (GRCm39) missense probably benign 0.13
R2168:Vps13b UTSW 15 35,792,334 (GRCm39) missense probably damaging 1.00
R2168:Vps13b UTSW 15 35,792,335 (GRCm39) missense probably damaging 1.00
R2171:Vps13b UTSW 15 35,887,343 (GRCm39) missense probably benign 0.44
R2221:Vps13b UTSW 15 35,884,743 (GRCm39) missense probably benign
R2263:Vps13b UTSW 15 35,646,327 (GRCm39) missense probably benign 0.02
R2289:Vps13b UTSW 15 35,572,251 (GRCm39) missense probably damaging 1.00
R2316:Vps13b UTSW 15 35,675,045 (GRCm39) nonsense probably null
R2351:Vps13b UTSW 15 35,869,457 (GRCm39) missense probably damaging 1.00
R2512:Vps13b UTSW 15 35,884,701 (GRCm39) missense probably benign 0.35
R3054:Vps13b UTSW 15 35,646,507 (GRCm39) missense probably damaging 0.99
R3055:Vps13b UTSW 15 35,646,507 (GRCm39) missense probably damaging 0.99
R3196:Vps13b UTSW 15 35,869,541 (GRCm39) missense probably damaging 1.00
R3236:Vps13b UTSW 15 35,910,450 (GRCm39) missense probably benign 0.40
R3404:Vps13b UTSW 15 35,926,200 (GRCm39) missense probably damaging 1.00
R3722:Vps13b UTSW 15 35,671,528 (GRCm39) missense probably damaging 0.99
R4077:Vps13b UTSW 15 35,455,274 (GRCm39) missense probably damaging 0.99
R4153:Vps13b UTSW 15 35,792,173 (GRCm39) splice site probably null
R4224:Vps13b UTSW 15 35,876,565 (GRCm39) missense probably damaging 0.99
R4408:Vps13b UTSW 15 35,709,440 (GRCm39) missense probably damaging 0.98
R4431:Vps13b UTSW 15 35,770,899 (GRCm39) missense probably damaging 1.00
R4449:Vps13b UTSW 15 35,876,939 (GRCm39) missense possibly damaging 0.86
R4508:Vps13b UTSW 15 35,709,819 (GRCm39) missense possibly damaging 0.80
R4631:Vps13b UTSW 15 35,646,278 (GRCm39) missense possibly damaging 0.95
R4655:Vps13b UTSW 15 35,770,835 (GRCm39) missense probably benign
R4666:Vps13b UTSW 15 35,640,690 (GRCm39) missense probably benign 0.13
R4684:Vps13b UTSW 15 35,879,967 (GRCm39) missense probably benign
R4684:Vps13b UTSW 15 35,841,487 (GRCm39) missense probably benign
R4684:Vps13b UTSW 15 35,646,324 (GRCm39) missense probably damaging 0.98
R4721:Vps13b UTSW 15 35,910,864 (GRCm39) nonsense probably null
R4771:Vps13b UTSW 15 35,910,946 (GRCm39) missense probably damaging 1.00
R4830:Vps13b UTSW 15 35,452,370 (GRCm39) missense possibly damaging 0.94
R4835:Vps13b UTSW 15 35,869,518 (GRCm39) missense probably damaging 1.00
R4835:Vps13b UTSW 15 35,910,439 (GRCm39) missense probably benign
R4857:Vps13b UTSW 15 35,456,800 (GRCm39) missense probably benign 0.01
R4891:Vps13b UTSW 15 35,640,661 (GRCm39) splice site probably null
R5095:Vps13b UTSW 15 35,923,348 (GRCm39) missense probably damaging 1.00
R5110:Vps13b UTSW 15 35,770,955 (GRCm39) missense probably damaging 0.99
R5147:Vps13b UTSW 15 35,456,824 (GRCm39) missense probably benign 0.32
R5153:Vps13b UTSW 15 35,422,599 (GRCm39) missense probably damaging 0.99
R5257:Vps13b UTSW 15 35,794,567 (GRCm39) missense possibly damaging 0.75
R5258:Vps13b UTSW 15 35,794,567 (GRCm39) missense possibly damaging 0.75
R5296:Vps13b UTSW 15 35,876,559 (GRCm39) missense probably damaging 1.00
R5386:Vps13b UTSW 15 35,640,674 (GRCm39) critical splice acceptor site probably null
R5396:Vps13b UTSW 15 35,887,094 (GRCm39) missense probably damaging 0.99
R5412:Vps13b UTSW 15 35,533,531 (GRCm39) missense probably damaging 1.00
R5488:Vps13b UTSW 15 35,770,688 (GRCm39) missense probably benign
R5489:Vps13b UTSW 15 35,770,688 (GRCm39) missense probably benign
R5503:Vps13b UTSW 15 35,452,312 (GRCm39) missense probably damaging 0.97
R5575:Vps13b UTSW 15 35,930,065 (GRCm39) missense probably damaging 1.00
R5781:Vps13b UTSW 15 35,794,181 (GRCm39) missense probably damaging 0.97
R5872:Vps13b UTSW 15 35,869,497 (GRCm39) missense possibly damaging 0.56
R5876:Vps13b UTSW 15 35,917,207 (GRCm39) missense probably damaging 0.99
R5994:Vps13b UTSW 15 35,875,918 (GRCm39) missense probably damaging 1.00
R6031:Vps13b UTSW 15 35,472,114 (GRCm39) missense probably damaging 1.00
R6031:Vps13b UTSW 15 35,472,114 (GRCm39) missense probably damaging 1.00
R6045:Vps13b UTSW 15 35,671,462 (GRCm39) missense probably damaging 0.99
R6143:Vps13b UTSW 15 35,668,884 (GRCm39) missense probably damaging 0.99
R6147:Vps13b UTSW 15 35,930,177 (GRCm39) missense probably benign 0.16
R6218:Vps13b UTSW 15 35,770,610 (GRCm39) missense probably benign 0.00
R6447:Vps13b UTSW 15 35,572,272 (GRCm39) missense probably benign 0.02
R6555:Vps13b UTSW 15 35,846,993 (GRCm39) missense probably damaging 1.00
R6578:Vps13b UTSW 15 35,446,247 (GRCm39) missense probably damaging 0.99
R6640:Vps13b UTSW 15 35,617,842 (GRCm39) missense possibly damaging 0.93
R6645:Vps13b UTSW 15 35,910,451 (GRCm39) missense probably benign 0.25
R6711:Vps13b UTSW 15 35,887,395 (GRCm39) missense probably damaging 1.00
R6727:Vps13b UTSW 15 35,770,829 (GRCm39) missense probably benign 0.19
R6737:Vps13b UTSW 15 35,910,757 (GRCm39) missense probably damaging 1.00
R6844:Vps13b UTSW 15 35,877,736 (GRCm39) missense probably benign 0.06
R6849:Vps13b UTSW 15 35,905,455 (GRCm39) missense probably damaging 1.00
R6861:Vps13b UTSW 15 35,576,541 (GRCm39) missense probably damaging 0.99
R6938:Vps13b UTSW 15 35,423,344 (GRCm39) missense probably damaging 0.99
R6943:Vps13b UTSW 15 35,448,835 (GRCm39) missense possibly damaging 0.95
R6989:Vps13b UTSW 15 35,448,727 (GRCm39) missense probably benign 0.02
R7092:Vps13b UTSW 15 35,640,780 (GRCm39) missense probably damaging 1.00
R7232:Vps13b UTSW 15 35,877,703 (GRCm39) missense probably damaging 1.00
R7307:Vps13b UTSW 15 35,841,691 (GRCm39) missense probably benign
R7400:Vps13b UTSW 15 35,379,046 (GRCm39) missense probably damaging 1.00
R7414:Vps13b UTSW 15 35,910,973 (GRCm39) missense probably damaging 1.00
R7497:Vps13b UTSW 15 35,876,843 (GRCm39) missense probably benign 0.38
R7500:Vps13b UTSW 15 35,910,670 (GRCm39) missense possibly damaging 0.74
R7603:Vps13b UTSW 15 35,576,585 (GRCm39) missense probably damaging 0.98
R7605:Vps13b UTSW 15 35,770,792 (GRCm39) missense probably damaging 0.97
R7849:Vps13b UTSW 15 35,423,378 (GRCm39) missense probably damaging 0.99
R7984:Vps13b UTSW 15 35,880,059 (GRCm39) missense probably benign
R8094:Vps13b UTSW 15 35,669,052 (GRCm39) critical splice donor site probably null
R8097:Vps13b UTSW 15 35,709,492 (GRCm39) missense probably benign 0.38
R8131:Vps13b UTSW 15 35,372,255 (GRCm39) critical splice donor site probably null
R8139:Vps13b UTSW 15 35,607,418 (GRCm39) nonsense probably null
R8174:Vps13b UTSW 15 35,709,456 (GRCm39) nonsense probably null
R8225:Vps13b UTSW 15 35,794,528 (GRCm39) missense probably damaging 0.99
R8239:Vps13b UTSW 15 35,597,550 (GRCm39) missense probably damaging 1.00
R8244:Vps13b UTSW 15 35,917,349 (GRCm39) missense probably damaging 1.00
R8303:Vps13b UTSW 15 35,640,063 (GRCm39) missense probably damaging 1.00
R8311:Vps13b UTSW 15 35,887,100 (GRCm39) missense probably benign 0.37
R8443:Vps13b UTSW 15 35,455,246 (GRCm39) missense probably benign
R8494:Vps13b UTSW 15 35,422,594 (GRCm39) missense probably damaging 0.99
R8499:Vps13b UTSW 15 35,841,466 (GRCm39) missense probably damaging 1.00
R8506:Vps13b UTSW 15 35,446,891 (GRCm39) missense probably benign 0.31
R8559:Vps13b UTSW 15 35,876,788 (GRCm39) missense probably damaging 1.00
R8686:Vps13b UTSW 15 35,925,535 (GRCm39) missense probably damaging 0.99
R8782:Vps13b UTSW 15 35,422,483 (GRCm39) missense possibly damaging 0.93
R8806:Vps13b UTSW 15 35,472,212 (GRCm39) critical splice donor site probably benign
R8824:Vps13b UTSW 15 35,533,445 (GRCm39) missense probably damaging 0.99
R9024:Vps13b UTSW 15 35,923,470 (GRCm39) missense probably damaging 0.97
R9038:Vps13b UTSW 15 35,875,931 (GRCm39) missense possibly damaging 0.70
R9054:Vps13b UTSW 15 35,422,537 (GRCm39) missense probably damaging 1.00
R9091:Vps13b UTSW 15 35,770,919 (GRCm39) missense probably benign 0.13
R9129:Vps13b UTSW 15 35,448,793 (GRCm39) missense probably damaging 1.00
R9214:Vps13b UTSW 15 35,623,892 (GRCm39) missense probably damaging 0.99
R9237:Vps13b UTSW 15 35,841,479 (GRCm39) missense probably damaging 1.00
R9256:Vps13b UTSW 15 35,623,925 (GRCm39) missense possibly damaging 0.95
R9270:Vps13b UTSW 15 35,770,919 (GRCm39) missense probably benign 0.13
R9279:Vps13b UTSW 15 35,572,290 (GRCm39) missense probably damaging 0.97
R9291:Vps13b UTSW 15 35,847,059 (GRCm39) missense probably damaging 1.00
R9342:Vps13b UTSW 15 35,455,200 (GRCm39) missense possibly damaging 0.94
R9404:Vps13b UTSW 15 35,876,565 (GRCm39) missense probably damaging 1.00
R9488:Vps13b UTSW 15 35,447,880 (GRCm39) missense possibly damaging 0.77
R9509:Vps13b UTSW 15 35,841,457 (GRCm39) missense possibly damaging 0.79
R9610:Vps13b UTSW 15 35,642,555 (GRCm39) missense possibly damaging 0.85
R9611:Vps13b UTSW 15 35,642,555 (GRCm39) missense possibly damaging 0.85
R9658:Vps13b UTSW 15 35,623,774 (GRCm39) missense probably benign 0.00
R9674:Vps13b UTSW 15 35,607,380 (GRCm39) missense probably damaging 0.98
R9696:Vps13b UTSW 15 35,675,033 (GRCm39) missense possibly damaging 0.56
R9767:Vps13b UTSW 15 35,910,403 (GRCm39) missense probably damaging 1.00
R9797:Vps13b UTSW 15 35,675,022 (GRCm39) missense probably damaging 1.00
RF020:Vps13b UTSW 15 35,925,552 (GRCm39) missense probably null 1.00
X0026:Vps13b UTSW 15 35,910,792 (GRCm39) missense probably damaging 1.00
X0028:Vps13b UTSW 15 35,709,577 (GRCm39) missense probably benign 0.00
Z1177:Vps13b UTSW 15 35,669,031 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGTCCCTGGAGAGTTAGG -3'
(R):5'- GGGTTCTCACAGCTCACTTTAG -3'

Sequencing Primer
(F):5'- TCCCTGGAGAGTTAGGAAGTAG -3'
(R):5'- AGTCTACAGTGATTTATTGAAGTTGC -3'
Posted On 2014-06-23