Incidental Mutation 'R1850:Smchd1'
ID 208038
Institutional Source Beutler Lab
Gene Symbol Smchd1
Ensembl Gene ENSMUSG00000024054
Gene Name SMC hinge domain containing 1
Synonyms MommeD1, 4931400A14Rik
MMRRC Submission 039874-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.838) question?
Stock # R1850 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 71651484-71782338 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71696766 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1203 (D1203G)
Ref Sequence ENSEMBL: ENSMUSP00000121835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127430]
AlphaFold Q6P5D8
Predicted Effect probably damaging
Transcript: ENSMUST00000127430
AA Change: D1203G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054
AA Change: D1203G

DomainStartEndE-ValueType
Pfam:HATPase_c_3 139 299 6.8e-16 PFAM
low complexity region 451 457 N/A INTRINSIC
internal_repeat_1 859 1087 9.1e-5 PROSPERO
low complexity region 1185 1196 N/A INTRINSIC
internal_repeat_1 1205 1409 9.1e-5 PROSPERO
coiled coil region 1649 1680 N/A INTRINSIC
SMC_hinge 1721 1848 1.64e-15 SMART
low complexity region 1940 1954 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195774
Meta Mutation Damage Score 0.1477 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam28 T A 14: 68,876,644 (GRCm39) Q202L probably benign Het
Adgb C A 10: 10,318,246 (GRCm39) V199F probably damaging Het
Aff1 G T 5: 103,981,773 (GRCm39) R645S probably damaging Het
Aoc1 C T 6: 48,882,202 (GRCm39) S48F probably benign Het
Atf6 A T 1: 170,646,855 (GRCm39) N339K probably damaging Het
Bpifb3 C G 2: 153,771,264 (GRCm39) S392C possibly damaging Het
Camk1d T C 2: 5,366,826 (GRCm39) M130V probably benign Het
Ces1a T A 8: 93,753,954 (GRCm39) N350Y probably damaging Het
Cfap57 G A 4: 118,457,091 (GRCm39) R453C probably damaging Het
Chd4 T A 6: 125,098,619 (GRCm39) N1532K probably damaging Het
Chd5 T C 4: 152,454,990 (GRCm39) L824P probably damaging Het
Ckap5 G A 2: 91,426,058 (GRCm39) R1306H probably damaging Het
Crybg1 A G 10: 43,873,670 (GRCm39) F1146S probably damaging Het
Dusp12 G A 1: 170,708,198 (GRCm39) T173M probably benign Het
Dync2h1 T C 9: 7,001,448 (GRCm39) T3854A probably benign Het
Echdc1 A T 10: 29,220,599 (GRCm39) I252F probably damaging Het
Emc1 A T 4: 139,086,684 (GRCm39) probably benign Het
Fbn2 C A 18: 58,172,377 (GRCm39) probably benign Het
Fsip2 T A 2: 82,814,933 (GRCm39) N3555K possibly damaging Het
Gabra1 T A 11: 42,070,403 (GRCm39) T20S probably benign Het
Igf1 A C 10: 87,697,236 (GRCm39) T2P possibly damaging Het
Insyn1 A T 9: 58,406,392 (GRCm39) M101L probably benign Het
Jcad C A 18: 4,675,730 (GRCm39) T1164N possibly damaging Het
Kalrn A T 16: 33,796,293 (GRCm39) S2830T probably damaging Het
Lepr C A 4: 101,590,620 (GRCm39) A66E possibly damaging Het
Lmntd1 T A 6: 145,359,206 (GRCm39) M315L probably benign Het
Lrch3 A G 16: 32,807,163 (GRCm39) T479A probably benign Het
Macroh2a1 T C 13: 56,244,052 (GRCm39) probably benign Het
Matr3 A G 18: 35,715,110 (GRCm39) N237D probably damaging Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Mtif2 A G 11: 29,490,683 (GRCm39) I462M probably benign Het
Nrip1 T C 16: 76,090,232 (GRCm39) I442V probably damaging Het
Or11g25 G A 14: 50,723,055 (GRCm39) A47T probably benign Het
Or6b2b T A 1: 92,419,124 (GRCm39) M118L possibly damaging Het
Or8k35 A T 2: 86,424,448 (GRCm39) C241* probably null Het
Otogl T A 10: 107,713,925 (GRCm39) Y498F probably damaging Het
Pbx3 A T 2: 34,066,832 (GRCm39) F351I probably benign Het
Pcdh18 T C 3: 49,710,854 (GRCm39) T154A probably benign Het
Pex5l A T 3: 33,005,025 (GRCm39) probably null Het
Plec T C 15: 76,072,432 (GRCm39) I718V probably benign Het
Pparg T A 6: 115,427,941 (GRCm39) Y143N probably damaging Het
Prl2c5 A G 13: 13,360,377 (GRCm39) I12V probably benign Het
Rcor3 T A 1: 191,804,411 (GRCm39) Q246L probably benign Het
Rnf214 A T 9: 45,780,746 (GRCm39) probably benign Het
S1pr5 A T 9: 21,155,425 (GRCm39) S334T probably benign Het
Scg3 C T 9: 75,589,449 (GRCm39) S35N possibly damaging Het
Septin5 A T 16: 18,443,960 (GRCm39) L19Q probably damaging Het
Serpinb7 T C 1: 107,356,025 (GRCm39) F16S probably damaging Het
Sipa1l3 A T 7: 29,038,551 (GRCm39) S365R probably damaging Het
Slc27a1 T C 8: 72,033,347 (GRCm39) probably null Het
Slc2a10 C A 2: 165,357,133 (GRCm39) H264Q probably benign Het
Slc9a3 A G 13: 74,309,889 (GRCm39) I526V probably benign Het
Spata6l T C 19: 28,916,571 (GRCm39) probably null Het
Sult1b1 A G 5: 87,668,700 (GRCm39) W181R probably damaging Het
Supt6 A G 11: 78,110,703 (GRCm39) probably benign Het
Tcf12 C A 9: 71,775,497 (GRCm39) A418S probably damaging Het
Tesk1 C T 4: 43,443,576 (GRCm39) R48C probably damaging Het
Tiam2 A G 17: 3,487,510 (GRCm39) Q677R probably damaging Het
Tspan8 C T 10: 115,669,130 (GRCm39) A55V probably damaging Het
Txndc11 T C 16: 10,906,268 (GRCm39) N421D probably damaging Het
Vmn1r201 A G 13: 22,658,801 (GRCm39) N5S probably benign Het
Vmn2r120 T A 17: 57,832,826 (GRCm39) I118L probably benign Het
Vps13b A T 15: 35,675,105 (GRCm39) probably benign Het
Wdfy3 A G 5: 102,042,865 (GRCm39) V1962A probably damaging Het
Zswim8 C T 14: 20,760,815 (GRCm39) R107* probably null Het
Other mutations in Smchd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Smchd1 APN 17 71,772,668 (GRCm39) splice site probably benign
IGL00529:Smchd1 APN 17 71,701,794 (GRCm39) missense probably benign 0.30
IGL00642:Smchd1 APN 17 71,697,427 (GRCm39) missense probably damaging 1.00
IGL00821:Smchd1 APN 17 71,705,618 (GRCm39) missense possibly damaging 0.92
IGL01330:Smchd1 APN 17 71,743,783 (GRCm39) missense probably benign
IGL01432:Smchd1 APN 17 71,738,285 (GRCm39) missense probably damaging 1.00
IGL01473:Smchd1 APN 17 71,696,745 (GRCm39) missense probably benign 0.00
IGL01705:Smchd1 APN 17 71,688,393 (GRCm39) missense probably damaging 1.00
IGL01787:Smchd1 APN 17 71,698,413 (GRCm39) missense probably damaging 0.99
IGL01814:Smchd1 APN 17 71,685,182 (GRCm39) missense probably benign 0.01
IGL01976:Smchd1 APN 17 71,701,720 (GRCm39) nonsense probably null
IGL01995:Smchd1 APN 17 71,751,015 (GRCm39) missense probably damaging 0.98
IGL02090:Smchd1 APN 17 71,738,248 (GRCm39) missense possibly damaging 0.86
IGL02302:Smchd1 APN 17 71,665,128 (GRCm39) splice site probably benign
IGL02309:Smchd1 APN 17 71,750,898 (GRCm39) missense probably benign 0.32
IGL02391:Smchd1 APN 17 71,738,254 (GRCm39) missense probably null 1.00
IGL02515:Smchd1 APN 17 71,747,952 (GRCm39) missense probably damaging 1.00
IGL02644:Smchd1 APN 17 71,667,016 (GRCm39) splice site probably benign
IGL03081:Smchd1 APN 17 71,667,186 (GRCm39) missense probably damaging 0.98
IGL03212:Smchd1 APN 17 71,750,886 (GRCm39) missense probably damaging 0.99
IGL03236:Smchd1 APN 17 71,698,425 (GRCm39) missense possibly damaging 0.88
IGL03297:Smchd1 APN 17 71,656,695 (GRCm39) missense probably benign 0.01
Dry_tortugas UTSW 17 71,747,951 (GRCm39) missense probably damaging 1.00
R0049:Smchd1 UTSW 17 71,738,231 (GRCm39) missense probably benign 0.01
R0254:Smchd1 UTSW 17 71,718,886 (GRCm39) missense probably benign 0.00
R0391:Smchd1 UTSW 17 71,710,149 (GRCm39) missense probably damaging 1.00
R0403:Smchd1 UTSW 17 71,701,897 (GRCm39) missense probably damaging 1.00
R0499:Smchd1 UTSW 17 71,694,083 (GRCm39) missense probably benign
R0520:Smchd1 UTSW 17 71,736,538 (GRCm39) missense possibly damaging 0.85
R0616:Smchd1 UTSW 17 71,686,569 (GRCm39) missense probably benign 0.39
R1120:Smchd1 UTSW 17 71,665,141 (GRCm39) nonsense probably null
R1469:Smchd1 UTSW 17 71,656,725 (GRCm39) missense probably damaging 1.00
R1469:Smchd1 UTSW 17 71,656,725 (GRCm39) missense probably damaging 1.00
R1473:Smchd1 UTSW 17 71,668,832 (GRCm39) splice site probably benign
R1484:Smchd1 UTSW 17 71,685,252 (GRCm39) missense probably benign 0.31
R1501:Smchd1 UTSW 17 71,672,089 (GRCm39) missense possibly damaging 0.54
R1718:Smchd1 UTSW 17 71,755,828 (GRCm39) missense possibly damaging 0.46
R1765:Smchd1 UTSW 17 71,707,196 (GRCm39) splice site probably benign
R1766:Smchd1 UTSW 17 71,698,374 (GRCm39) missense probably damaging 0.99
R1803:Smchd1 UTSW 17 71,694,001 (GRCm39) missense probably damaging 0.99
R1829:Smchd1 UTSW 17 71,677,332 (GRCm39) missense probably damaging 1.00
R1917:Smchd1 UTSW 17 71,714,232 (GRCm39) missense possibly damaging 0.48
R1918:Smchd1 UTSW 17 71,714,232 (GRCm39) missense possibly damaging 0.48
R1936:Smchd1 UTSW 17 71,770,786 (GRCm39) missense probably damaging 1.00
R2024:Smchd1 UTSW 17 71,677,923 (GRCm39) missense probably benign 0.15
R2147:Smchd1 UTSW 17 71,705,583 (GRCm39) missense possibly damaging 0.93
R2180:Smchd1 UTSW 17 71,770,794 (GRCm39) missense probably benign 0.23
R2398:Smchd1 UTSW 17 71,733,431 (GRCm39) splice site probably benign
R2398:Smchd1 UTSW 17 71,667,136 (GRCm39) missense probably damaging 1.00
R2935:Smchd1 UTSW 17 71,718,900 (GRCm39) missense probably damaging 1.00
R3000:Smchd1 UTSW 17 71,670,033 (GRCm39) missense probably benign 0.00
R3021:Smchd1 UTSW 17 71,694,093 (GRCm39) missense possibly damaging 0.75
R3808:Smchd1 UTSW 17 71,736,536 (GRCm39) missense probably damaging 1.00
R4323:Smchd1 UTSW 17 71,735,270 (GRCm39) missense probably benign 0.00
R4486:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4487:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4488:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4489:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4723:Smchd1 UTSW 17 71,743,742 (GRCm39) nonsense probably null
R4751:Smchd1 UTSW 17 71,698,463 (GRCm39) missense probably benign 0.01
R4798:Smchd1 UTSW 17 71,667,048 (GRCm39) nonsense probably null
R4814:Smchd1 UTSW 17 71,718,763 (GRCm39) critical splice donor site probably null
R4882:Smchd1 UTSW 17 71,665,234 (GRCm39) intron probably benign
R5088:Smchd1 UTSW 17 71,738,343 (GRCm39) missense possibly damaging 0.86
R5589:Smchd1 UTSW 17 71,747,956 (GRCm39) missense probably damaging 1.00
R5618:Smchd1 UTSW 17 71,762,722 (GRCm39) missense probably damaging 1.00
R5839:Smchd1 UTSW 17 71,701,857 (GRCm39) missense probably damaging 0.98
R5994:Smchd1 UTSW 17 71,672,404 (GRCm39) missense possibly damaging 0.89
R6009:Smchd1 UTSW 17 71,747,951 (GRCm39) missense probably damaging 1.00
R6042:Smchd1 UTSW 17 71,684,052 (GRCm39) nonsense probably null
R6082:Smchd1 UTSW 17 71,656,714 (GRCm39) missense probably benign 0.09
R6126:Smchd1 UTSW 17 71,677,280 (GRCm39) missense probably damaging 1.00
R6294:Smchd1 UTSW 17 71,677,922 (GRCm39) missense probably benign 0.13
R6788:Smchd1 UTSW 17 71,782,096 (GRCm39) missense probably benign 0.02
R6853:Smchd1 UTSW 17 71,743,738 (GRCm39) missense probably damaging 1.00
R6875:Smchd1 UTSW 17 71,660,501 (GRCm39) missense probably damaging 1.00
R7026:Smchd1 UTSW 17 71,656,662 (GRCm39) missense probably benign
R7045:Smchd1 UTSW 17 71,722,039 (GRCm39) missense probably benign 0.22
R7068:Smchd1 UTSW 17 71,694,087 (GRCm39) missense probably benign 0.00
R7085:Smchd1 UTSW 17 71,672,214 (GRCm39) splice site probably null
R7089:Smchd1 UTSW 17 71,668,955 (GRCm39) missense probably benign 0.00
R7145:Smchd1 UTSW 17 71,685,202 (GRCm39) missense probably benign
R7158:Smchd1 UTSW 17 71,707,145 (GRCm39) missense probably damaging 0.99
R7180:Smchd1 UTSW 17 71,701,818 (GRCm39) missense probably damaging 0.99
R7183:Smchd1 UTSW 17 71,660,511 (GRCm39) missense probably benign 0.00
R7214:Smchd1 UTSW 17 71,652,359 (GRCm39) missense probably benign 0.15
R7414:Smchd1 UTSW 17 71,782,074 (GRCm39) missense probably damaging 0.99
R7512:Smchd1 UTSW 17 71,688,364 (GRCm39) missense possibly damaging 0.51
R7631:Smchd1 UTSW 17 71,705,684 (GRCm39) missense probably benign 0.10
R7641:Smchd1 UTSW 17 71,697,474 (GRCm39) missense probably benign 0.00
R7709:Smchd1 UTSW 17 71,665,193 (GRCm39) missense probably damaging 1.00
R7768:Smchd1 UTSW 17 71,718,906 (GRCm39) missense probably damaging 1.00
R7789:Smchd1 UTSW 17 71,782,296 (GRCm39) start gained probably benign
R7898:Smchd1 UTSW 17 71,684,813 (GRCm39) splice site probably null
R7965:Smchd1 UTSW 17 71,762,621 (GRCm39) missense possibly damaging 0.65
R8177:Smchd1 UTSW 17 71,697,448 (GRCm39) missense probably benign 0.28
R8359:Smchd1 UTSW 17 71,738,238 (GRCm39) missense probably damaging 0.99
R8370:Smchd1 UTSW 17 71,701,908 (GRCm39) missense probably benign 0.22
R8426:Smchd1 UTSW 17 71,755,598 (GRCm39) missense probably damaging 1.00
R8443:Smchd1 UTSW 17 71,714,244 (GRCm39) missense probably benign 0.18
R8948:Smchd1 UTSW 17 71,743,767 (GRCm39) missense probably damaging 1.00
R8954:Smchd1 UTSW 17 71,755,752 (GRCm39) missense probably damaging 1.00
R9041:Smchd1 UTSW 17 71,701,710 (GRCm39) critical splice donor site probably null
R9054:Smchd1 UTSW 17 71,670,017 (GRCm39) nonsense probably null
R9141:Smchd1 UTSW 17 71,672,125 (GRCm39) missense probably benign 0.00
R9169:Smchd1 UTSW 17 71,722,659 (GRCm39) missense probably damaging 1.00
R9231:Smchd1 UTSW 17 71,672,084 (GRCm39) missense probably benign 0.05
R9368:Smchd1 UTSW 17 71,694,071 (GRCm39) missense probably damaging 1.00
R9374:Smchd1 UTSW 17 71,718,843 (GRCm39) missense possibly damaging 0.61
R9416:Smchd1 UTSW 17 71,701,791 (GRCm39) missense probably benign 0.27
R9426:Smchd1 UTSW 17 71,672,125 (GRCm39) missense probably benign 0.00
R9491:Smchd1 UTSW 17 71,667,020 (GRCm39) critical splice donor site probably null
R9511:Smchd1 UTSW 17 71,750,899 (GRCm39) missense possibly damaging 0.65
R9591:Smchd1 UTSW 17 71,701,828 (GRCm39) missense probably damaging 1.00
R9593:Smchd1 UTSW 17 71,701,828 (GRCm39) missense probably damaging 1.00
Z1176:Smchd1 UTSW 17 71,668,836 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCACACCTGCTACGGTAAG -3'
(R):5'- GCACGGGCTCTTGATATAGTG -3'

Sequencing Primer
(F):5'- GGTAAGCATTTAGCCAAGTG -3'
(R):5'- CACGGGCTCTTGATATAGTGTAATG -3'
Posted On 2014-06-23