Mutagenetix > Incidental Mutations

Incidental Mutation 'R1851:Cxcr2'

208044

Institutional Source

Beutler Lab

Gene Symbol

Cxcr2

Ensembl Gene

ENSMUSG00000026180

Gene Name

chemokine (C-X-C motif) receptor 2

Synonyms

CD128, IL-8rb, Cmkar2, IL8RA, Il8rb, IL-8Rh, Gpcr16

MMRRC Submission

039875-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1851 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

74153989-74161246 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 74159279 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 311 (I311V)

Ref Sequence

ENSEMBL: ENSMUSP00000102512 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027372] [ENSMUST00000106899]

AlphaFold

P35343

Predicted Effect

probably benign
Transcript: ENSMUST00000027372
AA Change: I311V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000027372
Gene: ENSMUSG00000026180
AA Change: I311V

Domain	Start	End	E-Value	Type
Pfam:7tm_1	64	313	1.2e-53	PFAM
low complexity region	346	358	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106899
AA Change: I311V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000102512
Gene: ENSMUSG00000026180
AA Change: I311V

Domain	Start	End	E-Value	Type
Pfam:7tm_1	64	313	1.1e-58	PFAM
low complexity region	346	358	N/A	INTRINSIC

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 94.9%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein-coupled receptor family. This protein is a receptor for interleukin 8 (IL8). It binds to IL8 with high affinity, and transduces the signal through a G-protein activated second messenger system. This receptor also binds to chemokine (C-X-C motif) ligand 1 (CXCL1/MGSA), a protein with melanoma growth stimulating activity, and has been shown to be a major component required for serum-dependent melanoma cell growth. This receptor mediates neutrophil migration to sites of inflammation. The angiogenic effects of IL8 in intestinal microvascular endothelial cells are found to be mediated by this receptor. Knockout studies in mice suggested that this receptor controls the positioning of oligodendrocyte precursors in developing spinal cord by arresting their migration. This gene, IL8RA, a gene encoding another high affinity IL8 receptor, as well as IL8RBP, a pseudogene of IL8RB, form a gene cluster in a region mapped to chromosome 2q33-q36. Alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile but exhibit splenomegaly, lymphadenopathy, and increased susceptibility to various pathogens due to impaired neutrophil recruitment and decreased pathogen clearance during innate immune responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730507C01Rik	A	G	12: 18,533,686	E225G	possibly damaging	Het
Abcb7	T	C	X: 104,305,399	M153V	probably benign	Het
Abi1	A	T	2: 22,950,264	V329D	possibly damaging	Het
Ablim3	G	A	18: 61,849,395	H160Y	probably benign	Het
Acox3	A	T	5: 35,609,062	D624V	possibly damaging	Het
Adam6b	A	G	12: 113,491,822	D753G	probably benign	Het
Ago1	C	A	4: 126,439,995	R771L	probably benign	Het
Aktip	A	G	8: 91,125,877	V217A	possibly damaging	Het
Ankk1	A	C	9: 49,415,850	H676Q	probably benign	Het
Arl1	G	C	10: 88,733,546		probably benign	Het
Asxl3	T	A	18: 22,517,739	D928E	probably damaging	Het
AW209491	T	C	13: 14,636,733	V57A	possibly damaging	Het
B3galt4	G	T	17: 33,950,911	Q118K	probably benign	Het
Ccdc187	A	T	2: 26,276,068	M783K	probably benign	Het
Cdon	T	G	9: 35,483,158	M900R	probably damaging	Het
Ceacam5	G	A	7: 17,714,910	W67*	probably null	Het
Chd5	A	G	4: 152,378,270	S1356G	probably damaging	Het
Chil3	C	T	3: 106,148,801		probably null	Het
Chmp7	C	T	14: 69,719,450	M336I	probably benign	Het
Cntn1	C	T	15: 92,305,140	R768C	probably damaging	Het
Col6a3	T	A	1: 90,807,534	I798F	possibly damaging	Het
Cpxcr1	T	A	X: 116,478,061	L223*	probably null	Het
Cpz	C	A	5: 35,502,558	R581L	possibly damaging	Het
Cym	T	A	3: 107,218,714	I78F	probably benign	Het
Defb8	A	T	8: 19,445,883	S54T	probably benign	Het
Dennd4a	A	G	9: 64,862,030	T433A	probably damaging	Het
Dhx29	A	G	13: 112,948,281	T678A	probably damaging	Het
Dspp	T	C	5: 104,174,085		probably null	Het
Enkur	G	T	2: 21,189,177	A195E	probably benign	Het
Ero1lb	T	A	13: 12,604,403	S429T	possibly damaging	Het
Fh1	A	G	1: 175,607,886	S344P	probably damaging	Het
Flnc	G	T	6: 29,443,479	G553V	probably damaging	Het
Fmo1	A	T	1: 162,829,985	L529*	probably null	Het
Frem1	C	A	4: 82,950,500	V1415F	probably damaging	Het
Gatb	T	G	3: 85,618,877	L354R	probably damaging	Het
Gdpgp1	A	T	7: 80,238,601	N127Y	probably damaging	Het
Gm11492	T	A	11: 87,568,915	D496E	probably damaging	Het
Gm13084	T	C	4: 143,812,826	I32M	probably benign	Het
Gm13212	T	G	4: 145,624,250		probably benign	Het
Gpat2	A	G	2: 127,434,819	T648A	possibly damaging	Het
Grk6	C	T	13: 55,451,778	R225*	probably null	Het
Hells	A	T	19: 38,959,676	Q682L	probably null	Het
Hspa5	T	A	2: 34,774,678	N381K	possibly damaging	Het
Ighmbp2	T	C	19: 3,262,075	N893S	probably benign	Het
Ipo11	A	T	13: 106,812,257	V914E	possibly damaging	Het
Lars	T	C	18: 42,212,608	N1001S	probably benign	Het
Lats2	A	G	14: 57,697,455	L606P	probably damaging	Het
Map4k1	T	C	7: 28,999,784	Y521H	probably benign	Het
March11	T	A	15: 26,387,830	V257E	probably damaging	Het
Med23	G	A	10: 24,910,870		probably null	Het
Meltf	A	G	16: 31,896,577	D696G	probably benign	Het
Ms4a7	T	A	19: 11,324,424	M212L	probably benign	Het
Mx1	A	T	16: 97,448,203	L608Q	probably damaging	Het
Myh1	T	C	11: 67,204,398	Y195H	probably damaging	Het
Napb	G	T	2: 148,706,989	H110Q	probably benign	Het
Ngly1	C	T	14: 16,260,585	P90S	probably damaging	Het
Nlrp1b	T	A	11: 71,182,616	I134L	possibly damaging	Het
Nup210	A	G	6: 91,016,054	L1017P	probably damaging	Het
Nup85	T	A	11: 115,581,817	I233N	probably damaging	Het
Obsl1	A	G	1: 75,492,893	V965A	probably damaging	Het
Olfr1259	A	C	2: 89,943,814	Y100*	probably null	Het
Olfr1310	T	C	2: 112,008,691	D165G	probably benign	Het
Olfr787	T	C	10: 129,463,501	L275P	probably damaging	Het
Pak1ip1	A	G	13: 41,011,232	T264A	possibly damaging	Het
Pard6g	C	T	18: 80,117,142	R157C	probably damaging	Het
Pcdhb7	A	T	18: 37,342,578	T256S	possibly damaging	Het
Phrf1	T	C	7: 141,240,918	F153L	probably damaging	Het
Pigw	A	T	11: 84,878,048	F152I	probably damaging	Het
Pip4k2c	A	G	10: 127,200,875	S222P	probably damaging	Het
Pjvk	A	G	2: 76,657,431		probably null	Het
Plxnd1	C	T	6: 115,963,914	V1355M	probably damaging	Het
Prss22	G	A	17: 23,996,314	P163S	probably damaging	Het
Prune2	A	G	19: 17,199,139	I154V	probably damaging	Het
Rapgef6	T	A	11: 54,642,811	D362E	probably benign	Het
Retreg2	A	G	1: 75,146,675	K416E	probably benign	Het
Scn7a	T	C	2: 66,680,291	I1256V	probably benign	Het
Sema4d	A	G	13: 51,711,222	V362A	possibly damaging	Het
Slc25a34	G	A	4: 141,622,268	T192I	probably benign	Het
Tacc3	G	T	5: 33,668,200	V425L	probably benign	Het
Tfdp2	A	T	9: 96,297,709	K125I	probably damaging	Het
Tjp2	C	T	19: 24,099,535	R952Q	possibly damaging	Het
Tk2	G	T	8: 104,248,445	S30*	probably null	Het
Tmem74	A	T	15: 43,867,163	D161E	probably benign	Het
Tmprss9	G	A	10: 80,892,285	V570M	probably damaging	Het
Tnk2	C	A	16: 32,679,462	P26Q	probably damaging	Het
Tnpo2	T	G	8: 85,051,772	V610G	probably damaging	Het
Trim37	T	C	11: 87,218,306	F953S	probably damaging	Het
U2surp	T	A	9: 95,482,097	K589*	probably null	Het
Usp2	G	A	9: 44,075,966	R187H	probably benign	Het
Vmn2r1	C	T	3: 64,101,505	T535I	probably benign	Het
Wdr20rt	T	A	12: 65,227,151	S463T	possibly damaging	Het
Zbtb25	C	A	12: 76,349,714	G245W	probably damaging	Het
Zc3h14	T	A	12: 98,760,354	L27*	probably null	Het
Zfp2	T	C	11: 50,901,088	K43E	probably benign	Het
Zfp654	A	G	16: 64,785,128	Y904H	probably benign	Het

Other mutations in Cxcr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02128:Cxcr2	APN	1	74158994	missense	probably benign	0.07
IGL03384:Cxcr2	APN	1	74158791	missense	probably damaging	0.98
copperas	UTSW	1	74158460	missense	probably damaging	0.98
R0780:Cxcr2	UTSW	1	74159175	missense	probably damaging	0.97
R1178:Cxcr2	UTSW	1	74158368	missense	probably benign	0.04
R1180:Cxcr2	UTSW	1	74158368	missense	probably benign	0.04
R1448:Cxcr2	UTSW	1	74158368	missense	probably benign	0.04
R1535:Cxcr2	UTSW	1	74159058	missense	probably damaging	1.00
R1852:Cxcr2	UTSW	1	74159279	missense	probably benign	0.01
R2897:Cxcr2	UTSW	1	74158971	missense	probably benign	0.04
R2898:Cxcr2	UTSW	1	74158971	missense	probably benign	0.04
R4430:Cxcr2	UTSW	1	74158845	missense	probably benign	0.01
R4542:Cxcr2	UTSW	1	74158529	missense	probably benign	0.02
R5625:Cxcr2	UTSW	1	74158832	nonsense	probably null
R5996:Cxcr2	UTSW	1	74158460	missense	probably damaging	0.98
R6737:Cxcr2	UTSW	1	74158631	missense	probably benign
R7206:Cxcr2	UTSW	1	74159054	missense	possibly damaging	0.69
R7577:Cxcr2	UTSW	1	74158915	missense	probably benign	0.00
R7717:Cxcr2	UTSW	1	74158839	missense	probably benign	0.05
R7873:Cxcr2	UTSW	1	74159007	missense	probably benign	0.14
R8300:Cxcr2	UTSW	1	74159174	missense	probably benign	0.01
R9224:Cxcr2	UTSW	1	74158597	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTCTTTAAGGCCCACATGG -3'
(R):5'- CTCTGGTAATGAGCCATGCTG -3'

Sequencing Primer
(F):5'- ATGCGGGTCATCTTCGC -3'
(R):5'- CTGGTAATGAGCCATGCTGAAAGAC -3'

Posted On

2014-06-23