Incidental Mutation 'R1851:Col6a3'
ID 208047
Institutional Source Beutler Lab
Gene Symbol Col6a3
Ensembl Gene ENSMUSG00000048126
Gene Name collagen, type VI, alpha 3
Synonyms Col6a-3
MMRRC Submission 039875-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1851 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 90765923-90843971 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 90807534 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 798 (I798F)
Ref Sequence ENSEMBL: ENSMUSP00000140858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056925] [ENSMUST00000097653] [ENSMUST00000130846] [ENSMUST00000188587]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000056925
AA Change: I1405F

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000057131
Gene: ENSMUSG00000048126
AA Change: I1405F

DomainStartEndE-ValueType
VWA 36 214 3.58e-42 SMART
VWA 239 415 3.34e-42 SMART
VWA 442 617 7.27e-43 SMART
VWA 636 813 7.8e-43 SMART
VWA 834 1010 4.21e-39 SMART
VWA 1024 1203 3.02e-40 SMART
VWA 1228 1406 1.1e-42 SMART
VWA 1431 1604 9.17e-40 SMART
VWA 1634 1807 1.78e-37 SMART
VWA 1833 2022 7.92e-3 SMART
Pfam:Collagen 2033 2094 2e-10 PFAM
Pfam:Collagen 2077 2142 2.8e-10 PFAM
low complexity region 2179 2222 N/A INTRINSIC
low complexity region 2228 2279 N/A INTRINSIC
Pfam:Collagen 2311 2373 7.9e-11 PFAM
VWA 2397 2576 3.95e-21 SMART
VWA 2614 2813 2.25e-25 SMART
low complexity region 2864 2880 N/A INTRINSIC
low complexity region 2886 2900 N/A INTRINSIC
low complexity region 2903 2941 N/A INTRINSIC
low complexity region 2945 3024 N/A INTRINSIC
low complexity region 3039 3076 N/A INTRINSIC
low complexity region 3091 3103 N/A INTRINSIC
FN3 3104 3183 4.6e-1 SMART
KU 3226 3279 4.34e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097653
AA Change: I798F

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000137585
Gene: ENSMUSG00000048126
AA Change: I798F

DomainStartEndE-ValueType
VWA 35 210 7.27e-43 SMART
VWA 227 403 4.21e-39 SMART
VWA 417 596 3.02e-40 SMART
VWA 621 799 1.1e-42 SMART
VWA 824 997 9.17e-40 SMART
VWA 1027 1200 1.78e-37 SMART
VWA 1226 1415 7.92e-3 SMART
Pfam:Collagen 1426 1486 9.2e-10 PFAM
Pfam:Collagen 1473 1539 2.2e-9 PFAM
low complexity region 1572 1615 N/A INTRINSIC
low complexity region 1621 1672 N/A INTRINSIC
low complexity region 1690 1704 N/A INTRINSIC
low complexity region 1713 1734 N/A INTRINSIC
VWA 1790 1969 3.95e-21 SMART
VWA 2007 2206 2.25e-25 SMART
low complexity region 2257 2273 N/A INTRINSIC
low complexity region 2279 2293 N/A INTRINSIC
low complexity region 2296 2334 N/A INTRINSIC
low complexity region 2338 2417 N/A INTRINSIC
low complexity region 2432 2469 N/A INTRINSIC
low complexity region 2484 2496 N/A INTRINSIC
FN3 2497 2576 4.6e-1 SMART
KU 2619 2672 4.34e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130846
AA Change: I1405F

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000115210
Gene: ENSMUSG00000048126
AA Change: I1405F

DomainStartEndE-ValueType
VWA 36 214 3.58e-42 SMART
VWA 239 415 3.34e-42 SMART
VWA 442 617 7.27e-43 SMART
VWA 636 813 7.8e-43 SMART
VWA 834 1010 4.21e-39 SMART
VWA 1024 1203 3.02e-40 SMART
VWA 1228 1406 1.1e-42 SMART
VWA 1431 1604 9.17e-40 SMART
Pfam:VWA 1636 1703 1.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136916
Predicted Effect possibly damaging
Transcript: ENSMUST00000188587
AA Change: I798F

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140858
Gene: ENSMUSG00000048126
AA Change: I798F

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWA 35 210 4.7e-45 SMART
VWA 227 403 2.7e-41 SMART
VWA 417 596 2e-42 SMART
VWA 621 799 7e-45 SMART
VWA 824 997 5.8e-42 SMART
VWA 1027 1200 1.1e-39 SMART
VWA 1226 1415 4.8e-5 SMART
Pfam:Collagen 1426 1486 3.8e-8 PFAM
Pfam:Collagen 1473 1539 9.1e-8 PFAM
low complexity region 1572 1615 N/A INTRINSIC
low complexity region 1621 1672 N/A INTRINSIC
low complexity region 1690 1704 N/A INTRINSIC
low complexity region 1713 1734 N/A INTRINSIC
VWA 1790 1969 2.4e-23 SMART
VWA 2007 2206 1.4e-27 SMART
low complexity region 2257 2273 N/A INTRINSIC
low complexity region 2279 2293 N/A INTRINSIC
low complexity region 2296 2334 N/A INTRINSIC
low complexity region 2338 2417 N/A INTRINSIC
low complexity region 2432 2469 N/A INTRINSIC
low complexity region 2484 2496 N/A INTRINSIC
FN3 2497 2576 2.2e-3 SMART
KU 2619 2672 2.1e-26 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-3 chain, one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The alpha-3 chain of type VI collagen is much larger than the alpha-1 and -2 chains. This difference in size is largely due to an increase in the number of subdomains, similar to von Willebrand Factor type A domains, that are found in the amino terminal globular domain of all the alpha chains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in the type VI collagen genes are associated with Bethlem myopathy, a rare autosomal dominant proximal myopathy with early childhood onset. Mutations in this gene are also a cause of Ullrich congenital muscular dystrophy, also referred to as Ullrich scleroatonic muscular dystrophy, an autosomal recessive congenital myopathy that is more severe than Bethlem myopathy. Multiple transcript variants have been identified, but the full-length nature of only some of these variants has been described. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit mild myopathy, decreased skeletal muscle weight, increased collagen deposition in muscles, skeletal muscle interstitial fibrosis and abnormal tendon collagen fibril morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik A G 12: 18,533,686 E225G possibly damaging Het
Abcb7 T C X: 104,305,399 M153V probably benign Het
Abi1 A T 2: 22,950,264 V329D possibly damaging Het
Ablim3 G A 18: 61,849,395 H160Y probably benign Het
Acox3 A T 5: 35,609,062 D624V possibly damaging Het
Adam6b A G 12: 113,491,822 D753G probably benign Het
Ago1 C A 4: 126,439,995 R771L probably benign Het
Aktip A G 8: 91,125,877 V217A possibly damaging Het
Ankk1 A C 9: 49,415,850 H676Q probably benign Het
Arl1 G C 10: 88,733,546 probably benign Het
Asxl3 T A 18: 22,517,739 D928E probably damaging Het
AW209491 T C 13: 14,636,733 V57A possibly damaging Het
B3galt4 G T 17: 33,950,911 Q118K probably benign Het
Ccdc187 A T 2: 26,276,068 M783K probably benign Het
Cdon T G 9: 35,483,158 M900R probably damaging Het
Ceacam5 G A 7: 17,714,910 W67* probably null Het
Chd5 A G 4: 152,378,270 S1356G probably damaging Het
Chil3 C T 3: 106,148,801 probably null Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cntn1 C T 15: 92,305,140 R768C probably damaging Het
Cpxcr1 T A X: 116,478,061 L223* probably null Het
Cpz C A 5: 35,502,558 R581L possibly damaging Het
Cxcr2 A G 1: 74,159,279 I311V probably benign Het
Cym T A 3: 107,218,714 I78F probably benign Het
Defb8 A T 8: 19,445,883 S54T probably benign Het
Dennd4a A G 9: 64,862,030 T433A probably damaging Het
Dhx29 A G 13: 112,948,281 T678A probably damaging Het
Dspp T C 5: 104,174,085 probably null Het
Enkur G T 2: 21,189,177 A195E probably benign Het
Ero1lb T A 13: 12,604,403 S429T possibly damaging Het
Fh1 A G 1: 175,607,886 S344P probably damaging Het
Flnc G T 6: 29,443,479 G553V probably damaging Het
Fmo1 A T 1: 162,829,985 L529* probably null Het
Frem1 C A 4: 82,950,500 V1415F probably damaging Het
Gatb T G 3: 85,618,877 L354R probably damaging Het
Gdpgp1 A T 7: 80,238,601 N127Y probably damaging Het
Gm11492 T A 11: 87,568,915 D496E probably damaging Het
Gm13084 T C 4: 143,812,826 I32M probably benign Het
Gm13212 T G 4: 145,624,250 probably benign Het
Gpat2 A G 2: 127,434,819 T648A possibly damaging Het
Grk6 C T 13: 55,451,778 R225* probably null Het
Hells A T 19: 38,959,676 Q682L probably null Het
Hspa5 T A 2: 34,774,678 N381K possibly damaging Het
Ighmbp2 T C 19: 3,262,075 N893S probably benign Het
Ipo11 A T 13: 106,812,257 V914E possibly damaging Het
Lars T C 18: 42,212,608 N1001S probably benign Het
Lats2 A G 14: 57,697,455 L606P probably damaging Het
Map4k1 T C 7: 28,999,784 Y521H probably benign Het
March11 T A 15: 26,387,830 V257E probably damaging Het
Med23 G A 10: 24,910,870 probably null Het
Meltf A G 16: 31,896,577 D696G probably benign Het
Ms4a7 T A 19: 11,324,424 M212L probably benign Het
Mx1 A T 16: 97,448,203 L608Q probably damaging Het
Myh1 T C 11: 67,204,398 Y195H probably damaging Het
Napb G T 2: 148,706,989 H110Q probably benign Het
Ngly1 C T 14: 16,260,585 P90S probably damaging Het
Nlrp1b T A 11: 71,182,616 I134L possibly damaging Het
Nup210 A G 6: 91,016,054 L1017P probably damaging Het
Nup85 T A 11: 115,581,817 I233N probably damaging Het
Obsl1 A G 1: 75,492,893 V965A probably damaging Het
Olfr1259 A C 2: 89,943,814 Y100* probably null Het
Olfr1310 T C 2: 112,008,691 D165G probably benign Het
Olfr787 T C 10: 129,463,501 L275P probably damaging Het
Pak1ip1 A G 13: 41,011,232 T264A possibly damaging Het
Pard6g C T 18: 80,117,142 R157C probably damaging Het
Pcdhb7 A T 18: 37,342,578 T256S possibly damaging Het
Phrf1 T C 7: 141,240,918 F153L probably damaging Het
Pigw A T 11: 84,878,048 F152I probably damaging Het
Pip4k2c A G 10: 127,200,875 S222P probably damaging Het
Pjvk A G 2: 76,657,431 probably null Het
Plxnd1 C T 6: 115,963,914 V1355M probably damaging Het
Prss22 G A 17: 23,996,314 P163S probably damaging Het
Prune2 A G 19: 17,199,139 I154V probably damaging Het
Rapgef6 T A 11: 54,642,811 D362E probably benign Het
Retreg2 A G 1: 75,146,675 K416E probably benign Het
Scn7a T C 2: 66,680,291 I1256V probably benign Het
Sema4d A G 13: 51,711,222 V362A possibly damaging Het
Slc25a34 G A 4: 141,622,268 T192I probably benign Het
Tacc3 G T 5: 33,668,200 V425L probably benign Het
Tfdp2 A T 9: 96,297,709 K125I probably damaging Het
Tjp2 C T 19: 24,099,535 R952Q possibly damaging Het
Tk2 G T 8: 104,248,445 S30* probably null Het
Tmem74 A T 15: 43,867,163 D161E probably benign Het
Tmprss9 G A 10: 80,892,285 V570M probably damaging Het
Tnk2 C A 16: 32,679,462 P26Q probably damaging Het
Tnpo2 T G 8: 85,051,772 V610G probably damaging Het
Trim37 T C 11: 87,218,306 F953S probably damaging Het
U2surp T A 9: 95,482,097 K589* probably null Het
Usp2 G A 9: 44,075,966 R187H probably benign Het
Vmn2r1 C T 3: 64,101,505 T535I probably benign Het
Wdr20rt T A 12: 65,227,151 S463T possibly damaging Het
Zbtb25 C A 12: 76,349,714 G245W probably damaging Het
Zc3h14 T A 12: 98,760,354 L27* probably null Het
Zfp2 T C 11: 50,901,088 K43E probably benign Het
Zfp654 A G 16: 64,785,128 Y904H probably benign Het
Other mutations in Col6a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Col6a3 APN 1 90828255 missense probably damaging 1.00
IGL00425:Col6a3 APN 1 90782026 missense unknown
IGL00541:Col6a3 APN 1 90802142 missense possibly damaging 0.83
IGL01063:Col6a3 APN 1 90802332 missense probably damaging 1.00
IGL01094:Col6a3 APN 1 90803933 missense possibly damaging 0.93
IGL01138:Col6a3 APN 1 90807510 missense probably damaging 1.00
IGL01291:Col6a3 APN 1 90802292 missense probably damaging 1.00
IGL01674:Col6a3 APN 1 90802514 missense probably damaging 1.00
IGL01756:Col6a3 APN 1 90779162 missense unknown
IGL01827:Col6a3 APN 1 90802319 missense probably damaging 1.00
IGL01845:Col6a3 APN 1 90796571 missense probably damaging 1.00
IGL01869:Col6a3 APN 1 90773048 missense unknown
IGL01900:Col6a3 APN 1 90795010 critical splice donor site probably null
IGL01925:Col6a3 APN 1 90802236 missense possibly damaging 0.95
IGL02002:Col6a3 APN 1 90782136 splice site probably benign
IGL02115:Col6a3 APN 1 90807651 missense probably damaging 0.99
IGL02302:Col6a3 APN 1 90781760 missense unknown
IGL02313:Col6a3 APN 1 90811606 missense probably damaging 1.00
IGL02458:Col6a3 APN 1 90779197 missense unknown
IGL02821:Col6a3 APN 1 90803878 missense probably damaging 1.00
IGL02828:Col6a3 APN 1 90796559 missense probably damaging 1.00
IGL03112:Col6a3 APN 1 90811520 nonsense probably null
IGL03129:Col6a3 APN 1 90821862 missense probably damaging 1.00
IGL03132:Col6a3 APN 1 90803893 missense probably damaging 1.00
IGL03148:Col6a3 APN 1 90827866 missense probably benign 0.33
IGL03251:Col6a3 APN 1 90810176 missense probably damaging 1.00
bailey UTSW 1 90767606 critical splice acceptor site probably benign
barnum UTSW 1 90779152 missense unknown
Boneless UTSW 1 90779059 missense unknown
Noodloid UTSW 1 90779289 missense unknown
stringy UTSW 1 90803678 nonsense probably null
wonder UTSW 1 90791923 critical splice donor site probably null
ANU05:Col6a3 UTSW 1 90802292 missense probably damaging 1.00
IGL03048:Col6a3 UTSW 1 90810248 missense possibly damaging 0.58
PIT4810001:Col6a3 UTSW 1 90778794 missense unknown
R0020:Col6a3 UTSW 1 90811550 missense probably damaging 0.99
R0020:Col6a3 UTSW 1 90811550 missense probably damaging 0.99
R0033:Col6a3 UTSW 1 90802245 missense probably damaging 1.00
R0033:Col6a3 UTSW 1 90802245 missense probably damaging 1.00
R0105:Col6a3 UTSW 1 90798161 missense possibly damaging 0.65
R0116:Col6a3 UTSW 1 90813551 missense probably damaging 1.00
R0167:Col6a3 UTSW 1 90798173 missense probably damaging 1.00
R0319:Col6a3 UTSW 1 90807704 missense possibly damaging 0.95
R0348:Col6a3 UTSW 1 90828049 missense probably damaging 1.00
R0365:Col6a3 UTSW 1 90788216 missense unknown
R0512:Col6a3 UTSW 1 90821798 intron probably benign
R0564:Col6a3 UTSW 1 90807734 missense probably damaging 1.00
R0635:Col6a3 UTSW 1 90808086 splice site probably null
R0667:Col6a3 UTSW 1 90828101 missense probably damaging 0.98
R0680:Col6a3 UTSW 1 90778981 missense unknown
R0736:Col6a3 UTSW 1 90804089 missense possibly damaging 0.95
R0737:Col6a3 UTSW 1 90828298 missense probably damaging 1.00
R0747:Col6a3 UTSW 1 90802653 missense probably damaging 1.00
R1155:Col6a3 UTSW 1 90794325 missense probably null 1.00
R1169:Col6a3 UTSW 1 90822014 missense possibly damaging 0.67
R1180:Col6a3 UTSW 1 90781855 missense unknown
R1225:Col6a3 UTSW 1 90811516 missense probably damaging 1.00
R1343:Col6a3 UTSW 1 90768347 missense unknown
R1387:Col6a3 UTSW 1 90822416 intron probably benign
R1437:Col6a3 UTSW 1 90801376 missense probably damaging 1.00
R1448:Col6a3 UTSW 1 90781855 missense unknown
R1677:Col6a3 UTSW 1 90821861 missense probably benign 0.14
R1681:Col6a3 UTSW 1 90773502 missense unknown
R1711:Col6a3 UTSW 1 90830213 missense probably damaging 1.00
R1727:Col6a3 UTSW 1 90796574 critical splice acceptor site probably null
R1736:Col6a3 UTSW 1 90779059 missense unknown
R1738:Col6a3 UTSW 1 90816361 missense probably damaging 1.00
R1742:Col6a3 UTSW 1 90813794 missense probably damaging 1.00
R1809:Col6a3 UTSW 1 90827949 missense probably damaging 1.00
R1852:Col6a3 UTSW 1 90807534 missense possibly damaging 0.69
R1872:Col6a3 UTSW 1 90830214 missense probably damaging 0.96
R1889:Col6a3 UTSW 1 90803711 missense probably benign 0.00
R1895:Col6a3 UTSW 1 90803711 missense probably benign 0.00
R1908:Col6a3 UTSW 1 90811699 missense probably damaging 1.00
R1919:Col6a3 UTSW 1 90822359 missense possibly damaging 0.66
R1973:Col6a3 UTSW 1 90804175 missense probably damaging 1.00
R2083:Col6a3 UTSW 1 90782011 missense unknown
R2121:Col6a3 UTSW 1 90810365 missense probably damaging 1.00
R2197:Col6a3 UTSW 1 90803745 missense probably benign 0.09
R2448:Col6a3 UTSW 1 90813358 missense probably damaging 1.00
R2831:Col6a3 UTSW 1 90803713 missense possibly damaging 0.89
R2877:Col6a3 UTSW 1 90775599 missense unknown
R3052:Col6a3 UTSW 1 90802130 missense possibly damaging 0.71
R3104:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3105:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3106:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3418:Col6a3 UTSW 1 90804091 missense probably benign 0.42
R3419:Col6a3 UTSW 1 90804091 missense probably benign 0.42
R3837:Col6a3 UTSW 1 90780081 missense unknown
R4007:Col6a3 UTSW 1 90802569 missense probably damaging 1.00
R4082:Col6a3 UTSW 1 90821883 missense probably damaging 1.00
R4181:Col6a3 UTSW 1 90807614 missense probably damaging 1.00
R4200:Col6a3 UTSW 1 90801383 missense probably benign 0.28
R4244:Col6a3 UTSW 1 90786639 missense unknown
R4297:Col6a3 UTSW 1 90811378 missense probably damaging 1.00
R4302:Col6a3 UTSW 1 90807614 missense probably damaging 1.00
R4472:Col6a3 UTSW 1 90822014 missense probably benign 0.23
R4600:Col6a3 UTSW 1 90781904 missense unknown
R4683:Col6a3 UTSW 1 90773457 missense unknown
R4788:Col6a3 UTSW 1 90772950 critical splice donor site probably null
R4851:Col6a3 UTSW 1 90779289 missense unknown
R4899:Col6a3 UTSW 1 90802427 missense probably damaging 0.99
R4904:Col6a3 UTSW 1 90801442 missense probably damaging 1.00
R4908:Col6a3 UTSW 1 90807524 missense probably damaging 1.00
R4960:Col6a3 UTSW 1 90804218 missense probably damaging 1.00
R4981:Col6a3 UTSW 1 90778843 missense unknown
R5057:Col6a3 UTSW 1 90816130 missense possibly damaging 0.91
R5062:Col6a3 UTSW 1 90779352 missense unknown
R5105:Col6a3 UTSW 1 90798140 missense possibly damaging 0.81
R5127:Col6a3 UTSW 1 90768345 missense unknown
R5166:Col6a3 UTSW 1 90810608 missense probably damaging 1.00
R5168:Col6a3 UTSW 1 90773639 nonsense probably null
R5196:Col6a3 UTSW 1 90816538 splice site probably null
R5230:Col6a3 UTSW 1 90789054 missense unknown
R5268:Col6a3 UTSW 1 90785243 missense unknown
R5381:Col6a3 UTSW 1 90775612 missense unknown
R5392:Col6a3 UTSW 1 90801295 missense probably benign 0.41
R5445:Col6a3 UTSW 1 90782039 nonsense probably null
R5571:Col6a3 UTSW 1 90788216 missense unknown
R5665:Col6a3 UTSW 1 90827880 missense probably benign 0.00
R5902:Col6a3 UTSW 1 90802199 splice site probably null
R5914:Col6a3 UTSW 1 90776200 missense unknown
R5955:Col6a3 UTSW 1 90811441 missense probably damaging 1.00
R5977:Col6a3 UTSW 1 90821849 missense possibly damaging 0.82
R6006:Col6a3 UTSW 1 90768383 missense unknown
R6010:Col6a3 UTSW 1 90773497 missense unknown
R6025:Col6a3 UTSW 1 90828102 missense probably damaging 1.00
R6151:Col6a3 UTSW 1 90813753 missense possibly damaging 0.53
R6154:Col6a3 UTSW 1 90773665 missense unknown
R6181:Col6a3 UTSW 1 90816374 missense possibly damaging 0.95
R6197:Col6a3 UTSW 1 90822341 missense probably damaging 1.00
R6332:Col6a3 UTSW 1 90822233 missense probably damaging 1.00
R6362:Col6a3 UTSW 1 90810563 missense probably damaging 0.99
R6476:Col6a3 UTSW 1 90781812 missense unknown
R6484:Col6a3 UTSW 1 90791923 critical splice donor site probably null
R6701:Col6a3 UTSW 1 90792462 missense probably benign 0.14
R6702:Col6a3 UTSW 1 90779439 missense unknown
R6703:Col6a3 UTSW 1 90779439 missense unknown
R6703:Col6a3 UTSW 1 90792462 missense probably benign 0.14
R6724:Col6a3 UTSW 1 90779152 missense unknown
R6746:Col6a3 UTSW 1 90779045 missense unknown
R6797:Col6a3 UTSW 1 90804088 missense probably damaging 0.99
R6798:Col6a3 UTSW 1 90795009 splice site probably null
R6903:Col6a3 UTSW 1 90794207 missense probably damaging 1.00
R6925:Col6a3 UTSW 1 90816002 missense probably benign 0.00
R6978:Col6a3 UTSW 1 90807470 critical splice donor site probably null
R7058:Col6a3 UTSW 1 90828037 nonsense probably null
R7182:Col6a3 UTSW 1 90803678 nonsense probably null
R7294:Col6a3 UTSW 1 90828283 missense probably damaging 1.00
R7296:Col6a3 UTSW 1 90827986 missense probably benign 0.00
R7311:Col6a3 UTSW 1 90822291 missense probably damaging 1.00
R7412:Col6a3 UTSW 1 90828133 missense probably damaging 0.98
R7561:Col6a3 UTSW 1 90775741 missense unknown
R7575:Col6a3 UTSW 1 90810599 missense possibly damaging 0.92
R7659:Col6a3 UTSW 1 90781745 missense unknown
R7679:Col6a3 UTSW 1 90811751 missense possibly damaging 0.49
R7831:Col6a3 UTSW 1 90796546 nonsense probably null
R7855:Col6a3 UTSW 1 90810621 missense possibly damaging 0.57
R7990:Col6a3 UTSW 1 90781855 missense unknown
R8003:Col6a3 UTSW 1 90775733 missense unknown
R8007:Col6a3 UTSW 1 90777457 missense unknown
R8098:Col6a3 UTSW 1 90803661 missense probably benign
R8312:Col6a3 UTSW 1 90813690 missense possibly damaging 0.55
R8419:Col6a3 UTSW 1 90802213 missense probably damaging 1.00
R8723:Col6a3 UTSW 1 90767606 critical splice acceptor site probably benign
R8725:Col6a3 UTSW 1 90767606 critical splice acceptor site probably benign
R8737:Col6a3 UTSW 1 90800025 missense probably benign 0.10
R8742:Col6a3 UTSW 1 90767606 critical splice acceptor site probably benign
R8743:Col6a3 UTSW 1 90767606 critical splice acceptor site probably benign
R8744:Col6a3 UTSW 1 90767606 critical splice acceptor site probably benign
R8753:Col6a3 UTSW 1 90767606 critical splice acceptor site probably benign
R8754:Col6a3 UTSW 1 90767606 critical splice acceptor site probably benign
R8773:Col6a3 UTSW 1 90768449 missense unknown
R8857:Col6a3 UTSW 1 90775763 missense unknown
R8867:Col6a3 UTSW 1 90787951 missense unknown
R8887:Col6a3 UTSW 1 90828226 missense probably benign
R9049:Col6a3 UTSW 1 90779344 missense unknown
R9142:Col6a3 UTSW 1 90778844 missense unknown
R9155:Col6a3 UTSW 1 90810579 missense probably benign 0.27
R9249:Col6a3 UTSW 1 90779298 missense unknown
R9258:Col6a3 UTSW 1 90772981 missense unknown
R9274:Col6a3 UTSW 1 90779298 missense unknown
R9276:Col6a3 UTSW 1 90807681 missense possibly damaging 0.94
R9315:Col6a3 UTSW 1 90811257 critical splice donor site probably null
R9376:Col6a3 UTSW 1 90781801 missense unknown
R9377:Col6a3 UTSW 1 90816239 missense probably damaging 1.00
R9429:Col6a3 UTSW 1 90803863 missense probably benign 0.01
R9439:Col6a3 UTSW 1 90816433 missense probably damaging 1.00
RF005:Col6a3 UTSW 1 90811262 missense probably benign 0.00
RF012:Col6a3 UTSW 1 90810560 missense probably damaging 1.00
X0024:Col6a3 UTSW 1 90803637 critical splice donor site probably null
X0063:Col6a3 UTSW 1 90803905 missense probably damaging 1.00
X0067:Col6a3 UTSW 1 90811529 missense probably damaging 1.00
Z1177:Col6a3 UTSW 1 90811728 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TAATATGGGGAGATGTGCTCAG -3'
(R):5'- TGATGAGGTGGACGACTCAG -3'

Sequencing Primer
(F):5'- GCTCAGCCTACAATATATACTAGTGC -3'
(R):5'- GACTCAGCCGTGGAACTCAAG -3'
Posted On 2014-06-23