Mutagenetix > Incidental Mutations

Incidental Mutation 'R1851:Col6a3'

208047

Institutional Source

Beutler Lab

Gene Symbol

Col6a3

Ensembl Gene

ENSMUSG00000048126

Gene Name

collagen, type VI, alpha 3

Synonyms

Col6a-3

MMRRC Submission

039875-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1851 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

90765923-90843971 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 90807534 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 798 (I798F)

Ref Sequence

ENSEMBL: ENSMUSP00000140858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056925] [ENSMUST00000097653] [ENSMUST00000130846] [ENSMUST00000188587]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000056925
AA Change: I1405F

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000057131
Gene: ENSMUSG00000048126
AA Change: I1405F

Domain	Start	End	E-Value	Type
VWA	36	214	3.58e-42	SMART
VWA	239	415	3.34e-42	SMART
VWA	442	617	7.27e-43	SMART
VWA	636	813	7.8e-43	SMART
VWA	834	1010	4.21e-39	SMART
VWA	1024	1203	3.02e-40	SMART
VWA	1228	1406	1.1e-42	SMART
VWA	1431	1604	9.17e-40	SMART
VWA	1634	1807	1.78e-37	SMART
VWA	1833	2022	7.92e-3	SMART
Pfam:Collagen	2033	2094	2e-10	PFAM
Pfam:Collagen	2077	2142	2.8e-10	PFAM
low complexity region	2179	2222	N/A	INTRINSIC
low complexity region	2228	2279	N/A	INTRINSIC
Pfam:Collagen	2311	2373	7.9e-11	PFAM
VWA	2397	2576	3.95e-21	SMART
VWA	2614	2813	2.25e-25	SMART
low complexity region	2864	2880	N/A	INTRINSIC
low complexity region	2886	2900	N/A	INTRINSIC
low complexity region	2903	2941	N/A	INTRINSIC
low complexity region	2945	3024	N/A	INTRINSIC
low complexity region	3039	3076	N/A	INTRINSIC
low complexity region	3091	3103	N/A	INTRINSIC
FN3	3104	3183	4.6e-1	SMART
KU	3226	3279	4.34e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000097653
AA Change: I798F

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000137585
Gene: ENSMUSG00000048126
AA Change: I798F

Domain	Start	End	E-Value	Type
VWA	35	210	7.27e-43	SMART
VWA	227	403	4.21e-39	SMART
VWA	417	596	3.02e-40	SMART
VWA	621	799	1.1e-42	SMART
VWA	824	997	9.17e-40	SMART
VWA	1027	1200	1.78e-37	SMART
VWA	1226	1415	7.92e-3	SMART
Pfam:Collagen	1426	1486	9.2e-10	PFAM
Pfam:Collagen	1473	1539	2.2e-9	PFAM
low complexity region	1572	1615	N/A	INTRINSIC
low complexity region	1621	1672	N/A	INTRINSIC
low complexity region	1690	1704	N/A	INTRINSIC
low complexity region	1713	1734	N/A	INTRINSIC
VWA	1790	1969	3.95e-21	SMART
VWA	2007	2206	2.25e-25	SMART
low complexity region	2257	2273	N/A	INTRINSIC
low complexity region	2279	2293	N/A	INTRINSIC
low complexity region	2296	2334	N/A	INTRINSIC
low complexity region	2338	2417	N/A	INTRINSIC
low complexity region	2432	2469	N/A	INTRINSIC
low complexity region	2484	2496	N/A	INTRINSIC
FN3	2497	2576	4.6e-1	SMART
KU	2619	2672	4.34e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130846
AA Change: I1405F

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000115210
Gene: ENSMUSG00000048126
AA Change: I1405F

Domain	Start	End	E-Value	Type
VWA	36	214	3.58e-42	SMART
VWA	239	415	3.34e-42	SMART
VWA	442	617	7.27e-43	SMART
VWA	636	813	7.8e-43	SMART
VWA	834	1010	4.21e-39	SMART
VWA	1024	1203	3.02e-40	SMART
VWA	1228	1406	1.1e-42	SMART
VWA	1431	1604	9.17e-40	SMART
Pfam:VWA	1636	1703	1.4e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136916

Predicted Effect

possibly damaging
Transcript: ENSMUST00000188587
AA Change: I798F

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000140858
Gene: ENSMUSG00000048126
AA Change: I798F

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
VWA	35	210	4.7e-45	SMART
VWA	227	403	2.7e-41	SMART
VWA	417	596	2e-42	SMART
VWA	621	799	7e-45	SMART
VWA	824	997	5.8e-42	SMART
VWA	1027	1200	1.1e-39	SMART
VWA	1226	1415	4.8e-5	SMART
Pfam:Collagen	1426	1486	3.8e-8	PFAM
Pfam:Collagen	1473	1539	9.1e-8	PFAM
low complexity region	1572	1615	N/A	INTRINSIC
low complexity region	1621	1672	N/A	INTRINSIC
low complexity region	1690	1704	N/A	INTRINSIC
low complexity region	1713	1734	N/A	INTRINSIC
VWA	1790	1969	2.4e-23	SMART
VWA	2007	2206	1.4e-27	SMART
low complexity region	2257	2273	N/A	INTRINSIC
low complexity region	2279	2293	N/A	INTRINSIC
low complexity region	2296	2334	N/A	INTRINSIC
low complexity region	2338	2417	N/A	INTRINSIC
low complexity region	2432	2469	N/A	INTRINSIC
low complexity region	2484	2496	N/A	INTRINSIC
FN3	2497	2576	2.2e-3	SMART
KU	2619	2672	2.1e-26	SMART

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 94.9%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-3 chain, one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The alpha-3 chain of type VI collagen is much larger than the alpha-1 and -2 chains. This difference in size is largely due to an increase in the number of subdomains, similar to von Willebrand Factor type A domains, that are found in the amino terminal globular domain of all the alpha chains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in the type VI collagen genes are associated with Bethlem myopathy, a rare autosomal dominant proximal myopathy with early childhood onset. Mutations in this gene are also a cause of Ullrich congenital muscular dystrophy, also referred to as Ullrich scleroatonic muscular dystrophy, an autosomal recessive congenital myopathy that is more severe than Bethlem myopathy. Multiple transcript variants have been identified, but the full-length nature of only some of these variants has been described. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit mild myopathy, decreased skeletal muscle weight, increased collagen deposition in muscles, skeletal muscle interstitial fibrosis and abnormal tendon collagen fibril morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730507C01Rik	A	G	12: 18,533,686	E225G	possibly damaging	Het
Abcb7	T	C	X: 104,305,399	M153V	probably benign	Het
Abi1	A	T	2: 22,950,264	V329D	possibly damaging	Het
Ablim3	G	A	18: 61,849,395	H160Y	probably benign	Het
Acox3	A	T	5: 35,609,062	D624V	possibly damaging	Het
Adam6b	A	G	12: 113,491,822	D753G	probably benign	Het
Ago1	C	A	4: 126,439,995	R771L	probably benign	Het
Aktip	A	G	8: 91,125,877	V217A	possibly damaging	Het
Ankk1	A	C	9: 49,415,850	H676Q	probably benign	Het
Arl1	G	C	10: 88,733,546		probably benign	Het
Asxl3	T	A	18: 22,517,739	D928E	probably damaging	Het
AW209491	T	C	13: 14,636,733	V57A	possibly damaging	Het
B3galt4	G	T	17: 33,950,911	Q118K	probably benign	Het
Ccdc187	A	T	2: 26,276,068	M783K	probably benign	Het
Cdon	T	G	9: 35,483,158	M900R	probably damaging	Het
Ceacam5	G	A	7: 17,714,910	W67*	probably null	Het
Chd5	A	G	4: 152,378,270	S1356G	probably damaging	Het
Chil3	C	T	3: 106,148,801		probably null	Het
Chmp7	C	T	14: 69,719,450	M336I	probably benign	Het
Cntn1	C	T	15: 92,305,140	R768C	probably damaging	Het
Cpxcr1	T	A	X: 116,478,061	L223*	probably null	Het
Cpz	C	A	5: 35,502,558	R581L	possibly damaging	Het
Cxcr2	A	G	1: 74,159,279	I311V	probably benign	Het
Cym	T	A	3: 107,218,714	I78F	probably benign	Het
Defb8	A	T	8: 19,445,883	S54T	probably benign	Het
Dennd4a	A	G	9: 64,862,030	T433A	probably damaging	Het
Dhx29	A	G	13: 112,948,281	T678A	probably damaging	Het
Dspp	T	C	5: 104,174,085		probably null	Het
Enkur	G	T	2: 21,189,177	A195E	probably benign	Het
Ero1lb	T	A	13: 12,604,403	S429T	possibly damaging	Het
Fh1	A	G	1: 175,607,886	S344P	probably damaging	Het
Flnc	G	T	6: 29,443,479	G553V	probably damaging	Het
Fmo1	A	T	1: 162,829,985	L529*	probably null	Het
Frem1	C	A	4: 82,950,500	V1415F	probably damaging	Het
Gatb	T	G	3: 85,618,877	L354R	probably damaging	Het
Gdpgp1	A	T	7: 80,238,601	N127Y	probably damaging	Het
Gm11492	T	A	11: 87,568,915	D496E	probably damaging	Het
Gm13084	T	C	4: 143,812,826	I32M	probably benign	Het
Gm13212	T	G	4: 145,624,250		probably benign	Het
Gpat2	A	G	2: 127,434,819	T648A	possibly damaging	Het
Grk6	C	T	13: 55,451,778	R225*	probably null	Het
Hells	A	T	19: 38,959,676	Q682L	probably null	Het
Hspa5	T	A	2: 34,774,678	N381K	possibly damaging	Het
Ighmbp2	T	C	19: 3,262,075	N893S	probably benign	Het
Ipo11	A	T	13: 106,812,257	V914E	possibly damaging	Het
Lars	T	C	18: 42,212,608	N1001S	probably benign	Het
Lats2	A	G	14: 57,697,455	L606P	probably damaging	Het
Map4k1	T	C	7: 28,999,784	Y521H	probably benign	Het
March11	T	A	15: 26,387,830	V257E	probably damaging	Het
Med23	G	A	10: 24,910,870		probably null	Het
Meltf	A	G	16: 31,896,577	D696G	probably benign	Het
Ms4a7	T	A	19: 11,324,424	M212L	probably benign	Het
Mx1	A	T	16: 97,448,203	L608Q	probably damaging	Het
Myh1	T	C	11: 67,204,398	Y195H	probably damaging	Het
Napb	G	T	2: 148,706,989	H110Q	probably benign	Het
Ngly1	C	T	14: 16,260,585	P90S	probably damaging	Het
Nlrp1b	T	A	11: 71,182,616	I134L	possibly damaging	Het
Nup210	A	G	6: 91,016,054	L1017P	probably damaging	Het
Nup85	T	A	11: 115,581,817	I233N	probably damaging	Het
Obsl1	A	G	1: 75,492,893	V965A	probably damaging	Het
Olfr1259	A	C	2: 89,943,814	Y100*	probably null	Het
Olfr1310	T	C	2: 112,008,691	D165G	probably benign	Het
Olfr787	T	C	10: 129,463,501	L275P	probably damaging	Het
Pak1ip1	A	G	13: 41,011,232	T264A	possibly damaging	Het
Pard6g	C	T	18: 80,117,142	R157C	probably damaging	Het
Pcdhb7	A	T	18: 37,342,578	T256S	possibly damaging	Het
Phrf1	T	C	7: 141,240,918	F153L	probably damaging	Het
Pigw	A	T	11: 84,878,048	F152I	probably damaging	Het
Pip4k2c	A	G	10: 127,200,875	S222P	probably damaging	Het
Pjvk	A	G	2: 76,657,431		probably null	Het
Plxnd1	C	T	6: 115,963,914	V1355M	probably damaging	Het
Prss22	G	A	17: 23,996,314	P163S	probably damaging	Het
Prune2	A	G	19: 17,199,139	I154V	probably damaging	Het
Rapgef6	T	A	11: 54,642,811	D362E	probably benign	Het
Retreg2	A	G	1: 75,146,675	K416E	probably benign	Het
Scn7a	T	C	2: 66,680,291	I1256V	probably benign	Het
Sema4d	A	G	13: 51,711,222	V362A	possibly damaging	Het
Slc25a34	G	A	4: 141,622,268	T192I	probably benign	Het
Tacc3	G	T	5: 33,668,200	V425L	probably benign	Het
Tfdp2	A	T	9: 96,297,709	K125I	probably damaging	Het
Tjp2	C	T	19: 24,099,535	R952Q	possibly damaging	Het
Tk2	G	T	8: 104,248,445	S30*	probably null	Het
Tmem74	A	T	15: 43,867,163	D161E	probably benign	Het
Tmprss9	G	A	10: 80,892,285	V570M	probably damaging	Het
Tnk2	C	A	16: 32,679,462	P26Q	probably damaging	Het
Tnpo2	T	G	8: 85,051,772	V610G	probably damaging	Het
Trim37	T	C	11: 87,218,306	F953S	probably damaging	Het
U2surp	T	A	9: 95,482,097	K589*	probably null	Het
Usp2	G	A	9: 44,075,966	R187H	probably benign	Het
Vmn2r1	C	T	3: 64,101,505	T535I	probably benign	Het
Wdr20rt	T	A	12: 65,227,151	S463T	possibly damaging	Het
Zbtb25	C	A	12: 76,349,714	G245W	probably damaging	Het
Zc3h14	T	A	12: 98,760,354	L27*	probably null	Het
Zfp2	T	C	11: 50,901,088	K43E	probably benign	Het
Zfp654	A	G	16: 64,785,128	Y904H	probably benign	Het

Other mutations in Col6a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00391:Col6a3	APN	1	90828255	missense	probably damaging	1.00
IGL00425:Col6a3	APN	1	90782026	missense	unknown
IGL00541:Col6a3	APN	1	90802142	missense	possibly damaging	0.83
IGL01063:Col6a3	APN	1	90802332	missense	probably damaging	1.00
IGL01094:Col6a3	APN	1	90803933	missense	possibly damaging	0.93
IGL01138:Col6a3	APN	1	90807510	missense	probably damaging	1.00
IGL01291:Col6a3	APN	1	90802292	missense	probably damaging	1.00
IGL01674:Col6a3	APN	1	90802514	missense	probably damaging	1.00
IGL01756:Col6a3	APN	1	90779162	missense	unknown
IGL01827:Col6a3	APN	1	90802319	missense	probably damaging	1.00
IGL01845:Col6a3	APN	1	90796571	missense	probably damaging	1.00
IGL01869:Col6a3	APN	1	90773048	missense	unknown
IGL01900:Col6a3	APN	1	90795010	critical splice donor site	probably null
IGL01925:Col6a3	APN	1	90802236	missense	possibly damaging	0.95
IGL02002:Col6a3	APN	1	90782136	splice site	probably benign
IGL02115:Col6a3	APN	1	90807651	missense	probably damaging	0.99
IGL02302:Col6a3	APN	1	90781760	missense	unknown
IGL02313:Col6a3	APN	1	90811606	missense	probably damaging	1.00
IGL02458:Col6a3	APN	1	90779197	missense	unknown
IGL02821:Col6a3	APN	1	90803878	missense	probably damaging	1.00
IGL02828:Col6a3	APN	1	90796559	missense	probably damaging	1.00
IGL03112:Col6a3	APN	1	90811520	nonsense	probably null
IGL03129:Col6a3	APN	1	90821862	missense	probably damaging	1.00
IGL03132:Col6a3	APN	1	90803893	missense	probably damaging	1.00
IGL03148:Col6a3	APN	1	90827866	missense	probably benign	0.33
IGL03251:Col6a3	APN	1	90810176	missense	probably damaging	1.00
bailey	UTSW	1	90767606	critical splice acceptor site	probably benign
barnum	UTSW	1	90779152	missense	unknown
Boneless	UTSW	1	90779059	missense	unknown
Noodloid	UTSW	1	90779289	missense	unknown
stringy	UTSW	1	90803678	nonsense	probably null
wonder	UTSW	1	90791923	critical splice donor site	probably null
ANU05:Col6a3	UTSW	1	90802292	missense	probably damaging	1.00
IGL03048:Col6a3	UTSW	1	90810248	missense	possibly damaging	0.58
PIT4810001:Col6a3	UTSW	1	90778794	missense	unknown
R0020:Col6a3	UTSW	1	90811550	missense	probably damaging	0.99
R0020:Col6a3	UTSW	1	90811550	missense	probably damaging	0.99
R0033:Col6a3	UTSW	1	90802245	missense	probably damaging	1.00
R0033:Col6a3	UTSW	1	90802245	missense	probably damaging	1.00
R0105:Col6a3	UTSW	1	90798161	missense	possibly damaging	0.65
R0116:Col6a3	UTSW	1	90813551	missense	probably damaging	1.00
R0167:Col6a3	UTSW	1	90798173	missense	probably damaging	1.00
R0319:Col6a3	UTSW	1	90807704	missense	possibly damaging	0.95
R0348:Col6a3	UTSW	1	90828049	missense	probably damaging	1.00
R0365:Col6a3	UTSW	1	90788216	missense	unknown
R0512:Col6a3	UTSW	1	90821798	intron	probably benign
R0564:Col6a3	UTSW	1	90807734	missense	probably damaging	1.00
R0635:Col6a3	UTSW	1	90808086	splice site	probably null
R0667:Col6a3	UTSW	1	90828101	missense	probably damaging	0.98
R0680:Col6a3	UTSW	1	90778981	missense	unknown
R0736:Col6a3	UTSW	1	90804089	missense	possibly damaging	0.95
R0737:Col6a3	UTSW	1	90828298	missense	probably damaging	1.00
R0747:Col6a3	UTSW	1	90802653	missense	probably damaging	1.00
R1155:Col6a3	UTSW	1	90794325	missense	probably null	1.00
R1169:Col6a3	UTSW	1	90822014	missense	possibly damaging	0.67
R1180:Col6a3	UTSW	1	90781855	missense	unknown
R1225:Col6a3	UTSW	1	90811516	missense	probably damaging	1.00
R1343:Col6a3	UTSW	1	90768347	missense	unknown
R1387:Col6a3	UTSW	1	90822416	intron	probably benign
R1437:Col6a3	UTSW	1	90801376	missense	probably damaging	1.00
R1448:Col6a3	UTSW	1	90781855	missense	unknown
R1677:Col6a3	UTSW	1	90821861	missense	probably benign	0.14
R1681:Col6a3	UTSW	1	90773502	missense	unknown
R1711:Col6a3	UTSW	1	90830213	missense	probably damaging	1.00
R1727:Col6a3	UTSW	1	90796574	critical splice acceptor site	probably null
R1736:Col6a3	UTSW	1	90779059	missense	unknown
R1738:Col6a3	UTSW	1	90816361	missense	probably damaging	1.00
R1742:Col6a3	UTSW	1	90813794	missense	probably damaging	1.00
R1809:Col6a3	UTSW	1	90827949	missense	probably damaging	1.00
R1852:Col6a3	UTSW	1	90807534	missense	possibly damaging	0.69
R1872:Col6a3	UTSW	1	90830214	missense	probably damaging	0.96
R1889:Col6a3	UTSW	1	90803711	missense	probably benign	0.00
R1895:Col6a3	UTSW	1	90803711	missense	probably benign	0.00
R1908:Col6a3	UTSW	1	90811699	missense	probably damaging	1.00
R1919:Col6a3	UTSW	1	90822359	missense	possibly damaging	0.66
R1973:Col6a3	UTSW	1	90804175	missense	probably damaging	1.00
R2083:Col6a3	UTSW	1	90782011	missense	unknown
R2121:Col6a3	UTSW	1	90810365	missense	probably damaging	1.00
R2197:Col6a3	UTSW	1	90803745	missense	probably benign	0.09
R2448:Col6a3	UTSW	1	90813358	missense	probably damaging	1.00
R2831:Col6a3	UTSW	1	90803713	missense	possibly damaging	0.89
R2877:Col6a3	UTSW	1	90775599	missense	unknown
R3052:Col6a3	UTSW	1	90802130	missense	possibly damaging	0.71
R3104:Col6a3	UTSW	1	90816302	missense	probably damaging	0.99
R3105:Col6a3	UTSW	1	90816302	missense	probably damaging	0.99
R3106:Col6a3	UTSW	1	90816302	missense	probably damaging	0.99
R3418:Col6a3	UTSW	1	90804091	missense	probably benign	0.42
R3419:Col6a3	UTSW	1	90804091	missense	probably benign	0.42
R3837:Col6a3	UTSW	1	90780081	missense	unknown
R4007:Col6a3	UTSW	1	90802569	missense	probably damaging	1.00
R4082:Col6a3	UTSW	1	90821883	missense	probably damaging	1.00
R4181:Col6a3	UTSW	1	90807614	missense	probably damaging	1.00
R4200:Col6a3	UTSW	1	90801383	missense	probably benign	0.28
R4244:Col6a3	UTSW	1	90786639	missense	unknown
R4297:Col6a3	UTSW	1	90811378	missense	probably damaging	1.00
R4302:Col6a3	UTSW	1	90807614	missense	probably damaging	1.00
R4472:Col6a3	UTSW	1	90822014	missense	probably benign	0.23
R4600:Col6a3	UTSW	1	90781904	missense	unknown
R4683:Col6a3	UTSW	1	90773457	missense	unknown
R4788:Col6a3	UTSW	1	90772950	critical splice donor site	probably null
R4851:Col6a3	UTSW	1	90779289	missense	unknown
R4899:Col6a3	UTSW	1	90802427	missense	probably damaging	0.99
R4904:Col6a3	UTSW	1	90801442	missense	probably damaging	1.00
R4908:Col6a3	UTSW	1	90807524	missense	probably damaging	1.00
R4960:Col6a3	UTSW	1	90804218	missense	probably damaging	1.00
R4981:Col6a3	UTSW	1	90778843	missense	unknown
R5057:Col6a3	UTSW	1	90816130	missense	possibly damaging	0.91
R5062:Col6a3	UTSW	1	90779352	missense	unknown
R5105:Col6a3	UTSW	1	90798140	missense	possibly damaging	0.81
R5127:Col6a3	UTSW	1	90768345	missense	unknown
R5166:Col6a3	UTSW	1	90810608	missense	probably damaging	1.00
R5168:Col6a3	UTSW	1	90773639	nonsense	probably null
R5196:Col6a3	UTSW	1	90816538	splice site	probably null
R5230:Col6a3	UTSW	1	90789054	missense	unknown
R5268:Col6a3	UTSW	1	90785243	missense	unknown
R5381:Col6a3	UTSW	1	90775612	missense	unknown
R5392:Col6a3	UTSW	1	90801295	missense	probably benign	0.41
R5445:Col6a3	UTSW	1	90782039	nonsense	probably null
R5571:Col6a3	UTSW	1	90788216	missense	unknown
R5665:Col6a3	UTSW	1	90827880	missense	probably benign	0.00
R5902:Col6a3	UTSW	1	90802199	splice site	probably null
R5914:Col6a3	UTSW	1	90776200	missense	unknown
R5955:Col6a3	UTSW	1	90811441	missense	probably damaging	1.00
R5977:Col6a3	UTSW	1	90821849	missense	possibly damaging	0.82
R6006:Col6a3	UTSW	1	90768383	missense	unknown
R6010:Col6a3	UTSW	1	90773497	missense	unknown
R6025:Col6a3	UTSW	1	90828102	missense	probably damaging	1.00
R6151:Col6a3	UTSW	1	90813753	missense	possibly damaging	0.53
R6154:Col6a3	UTSW	1	90773665	missense	unknown
R6181:Col6a3	UTSW	1	90816374	missense	possibly damaging	0.95
R6197:Col6a3	UTSW	1	90822341	missense	probably damaging	1.00
R6332:Col6a3	UTSW	1	90822233	missense	probably damaging	1.00
R6362:Col6a3	UTSW	1	90810563	missense	probably damaging	0.99
R6476:Col6a3	UTSW	1	90781812	missense	unknown
R6484:Col6a3	UTSW	1	90791923	critical splice donor site	probably null
R6701:Col6a3	UTSW	1	90792462	missense	probably benign	0.14
R6702:Col6a3	UTSW	1	90779439	missense	unknown
R6703:Col6a3	UTSW	1	90779439	missense	unknown
R6703:Col6a3	UTSW	1	90792462	missense	probably benign	0.14
R6724:Col6a3	UTSW	1	90779152	missense	unknown
R6746:Col6a3	UTSW	1	90779045	missense	unknown
R6797:Col6a3	UTSW	1	90804088	missense	probably damaging	0.99
R6798:Col6a3	UTSW	1	90795009	splice site	probably null
R6903:Col6a3	UTSW	1	90794207	missense	probably damaging	1.00
R6925:Col6a3	UTSW	1	90816002	missense	probably benign	0.00
R6978:Col6a3	UTSW	1	90807470	critical splice donor site	probably null
R7058:Col6a3	UTSW	1	90828037	nonsense	probably null
R7182:Col6a3	UTSW	1	90803678	nonsense	probably null
R7294:Col6a3	UTSW	1	90828283	missense	probably damaging	1.00
R7296:Col6a3	UTSW	1	90827986	missense	probably benign	0.00
R7311:Col6a3	UTSW	1	90822291	missense	probably damaging	1.00
R7412:Col6a3	UTSW	1	90828133	missense	probably damaging	0.98
R7561:Col6a3	UTSW	1	90775741	missense	unknown
R7575:Col6a3	UTSW	1	90810599	missense	possibly damaging	0.92
R7659:Col6a3	UTSW	1	90781745	missense	unknown
R7679:Col6a3	UTSW	1	90811751	missense	possibly damaging	0.49
R7831:Col6a3	UTSW	1	90796546	nonsense	probably null
R7855:Col6a3	UTSW	1	90810621	missense	possibly damaging	0.57
R7990:Col6a3	UTSW	1	90781855	missense	unknown
R8003:Col6a3	UTSW	1	90775733	missense	unknown
R8007:Col6a3	UTSW	1	90777457	missense	unknown
R8098:Col6a3	UTSW	1	90803661	missense	probably benign
R8312:Col6a3	UTSW	1	90813690	missense	possibly damaging	0.55
R8419:Col6a3	UTSW	1	90802213	missense	probably damaging	1.00
R8723:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8725:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8737:Col6a3	UTSW	1	90800025	missense	probably benign	0.10
R8742:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8743:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8744:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8753:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8754:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8773:Col6a3	UTSW	1	90768449	missense	unknown
R8857:Col6a3	UTSW	1	90775763	missense	unknown
R8867:Col6a3	UTSW	1	90787951	missense	unknown
R8887:Col6a3	UTSW	1	90828226	missense	probably benign
R9049:Col6a3	UTSW	1	90779344	missense	unknown
R9142:Col6a3	UTSW	1	90778844	missense	unknown
R9155:Col6a3	UTSW	1	90810579	missense	probably benign	0.27
R9249:Col6a3	UTSW	1	90779298	missense	unknown
R9258:Col6a3	UTSW	1	90772981	missense	unknown
R9274:Col6a3	UTSW	1	90779298	missense	unknown
R9276:Col6a3	UTSW	1	90807681	missense	possibly damaging	0.94
R9315:Col6a3	UTSW	1	90811257	critical splice donor site	probably null
R9376:Col6a3	UTSW	1	90781801	missense	unknown
R9377:Col6a3	UTSW	1	90816239	missense	probably damaging	1.00
R9429:Col6a3	UTSW	1	90803863	missense	probably benign	0.01
R9439:Col6a3	UTSW	1	90816433	missense	probably damaging	1.00
RF005:Col6a3	UTSW	1	90811262	missense	probably benign	0.00
RF012:Col6a3	UTSW	1	90810560	missense	probably damaging	1.00
X0024:Col6a3	UTSW	1	90803637	critical splice donor site	probably null
X0063:Col6a3	UTSW	1	90803905	missense	probably damaging	1.00
X0067:Col6a3	UTSW	1	90811529	missense	probably damaging	1.00
Z1177:Col6a3	UTSW	1	90811728	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- TAATATGGGGAGATGTGCTCAG -3'
(R):5'- TGATGAGGTGGACGACTCAG -3'

Sequencing Primer
(F):5'- GCTCAGCCTACAATATATACTAGTGC -3'
(R):5'- GACTCAGCCGTGGAACTCAAG -3'

Posted On

2014-06-23