Incidental Mutation 'R1851:Abi1'
ID208052
Institutional Source Beutler Lab
Gene Symbol Abi1
Ensembl Gene ENSMUSG00000058835
Gene Nameabl-interactor 1
SynonymsE3B1, Ssh3bp1
MMRRC Submission 039875-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.789) question?
Stock #R1851 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location22940073-23040241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22950264 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 329 (V329D)
Ref Sequence ENSEMBL: ENSMUSP00000120462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078977] [ENSMUST00000091394] [ENSMUST00000093171] [ENSMUST00000114544] [ENSMUST00000123948] [ENSMUST00000126112] [ENSMUST00000139038] [ENSMUST00000140164] [ENSMUST00000149719] [ENSMUST00000153931] [ENSMUST00000178908]
Predicted Effect probably benign
Transcript: ENSMUST00000078977
SMART Domains Protein: ENSMUSP00000077997
Gene: ENSMUSG00000058835

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 3.7e-38 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 282 N/A INTRINSIC
low complexity region 296 303 N/A INTRINSIC
low complexity region 337 364 N/A INTRINSIC
SH3 393 448 2.38e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091394
AA Change: V334D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088957
Gene: ENSMUSG00000058835
AA Change: V334D

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 4.1e-38 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 281 N/A INTRINSIC
low complexity region 295 302 N/A INTRINSIC
low complexity region 336 351 N/A INTRINSIC
low complexity region 365 392 N/A INTRINSIC
SH3 421 476 2.38e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093171
SMART Domains Protein: ENSMUSP00000090860
Gene: ENSMUSG00000058835

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 3.7e-38 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 281 N/A INTRINSIC
low complexity region 295 302 N/A INTRINSIC
low complexity region 336 363 N/A INTRINSIC
SH3 392 447 2.38e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114544
SMART Domains Protein: ENSMUSP00000110191
Gene: ENSMUSG00000058835

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 170 4.4e-37 PFAM
low complexity region 171 180 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 268 300 N/A INTRINSIC
SH3 329 384 2.38e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000123948
AA Change: V335D

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118491
Gene: ENSMUSG00000058835
AA Change: V335D

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 170 5.1e-39 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 282 N/A INTRINSIC
low complexity region 296 303 N/A INTRINSIC
low complexity region 337 352 N/A INTRINSIC
low complexity region 366 393 N/A INTRINSIC
SH3 422 477 2.38e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000126112
AA Change: V330D

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117335
Gene: ENSMUSG00000058835
AA Change: V330D

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 170 8.6e-37 PFAM
low complexity region 171 180 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 291 298 N/A INTRINSIC
low complexity region 332 347 N/A INTRINSIC
low complexity region 361 388 N/A INTRINSIC
SH3 417 472 2.38e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135308
Predicted Effect probably benign
Transcript: ENSMUST00000139038
AA Change: V276D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116093
Gene: ENSMUSG00000058835
AA Change: V276D

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 3.4e-38 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 293 N/A INTRINSIC
low complexity region 307 334 N/A INTRINSIC
SH3 363 418 2.38e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000140164
AA Change: V329D

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120462
Gene: ENSMUSG00000058835
AA Change: V329D

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 170 8.6e-37 PFAM
low complexity region 171 180 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
low complexity region 290 297 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 360 387 N/A INTRINSIC
SH3 416 471 2.38e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148294
Predicted Effect probably benign
Transcript: ENSMUST00000149719
SMART Domains Protein: ENSMUSP00000120621
Gene: ENSMUSG00000058835

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 170 7.8e-37 PFAM
low complexity region 171 180 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
low complexity region 290 297 N/A INTRINSIC
low complexity region 331 358 N/A INTRINSIC
SH3 387 442 2.38e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153931
SMART Domains Protein: ENSMUSP00000120769
Gene: ENSMUSG00000058835

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 3e-38 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 273 305 N/A INTRINSIC
SH3 334 389 2.38e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156344
Predicted Effect possibly damaging
Transcript: ENSMUST00000178908
AA Change: V335D

PolyPhen 2 Score 0.542 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000136846
Gene: ENSMUSG00000058835
AA Change: V335D

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 3.9e-37 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 282 N/A INTRINSIC
low complexity region 296 303 N/A INTRINSIC
low complexity region 337 352 N/A INTRINSIC
low complexity region 366 393 N/A INTRINSIC
SH3 422 477 2.38e-23 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Abelson-interactor family of adaptor proteins. These proteins facilitate signal transduction as components of several multiprotein complexes, and regulate actin polymerization and cytoskeletal remodeling through interactions with Abelson tyrosine kinases. The encoded protein plays a role in macropinocytosis as a component of the WAVE2 complex, and also forms a complex with EPS8 and SOS1 that mediates signal transduction from Ras to Rac. This gene may play a role in the progression of several malignancies including melanoma, colon cancer and breast cancer, and a t(10;11) chromosomal translocation involving this gene and the MLL gene has been associated with acute myeloid leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 14. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit background sensitive embryonic lethality prior during organogenesis associated with about abnormal vasculogenesis and angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik A G 12: 18,533,686 E225G possibly damaging Het
Abcb7 T C X: 104,305,399 M153V probably benign Het
Ablim3 G A 18: 61,849,395 H160Y probably benign Het
Acox3 A T 5: 35,609,062 D624V possibly damaging Het
Adam6b A G 12: 113,491,822 D753G probably benign Het
Ago1 C A 4: 126,439,995 R771L probably benign Het
Aktip A G 8: 91,125,877 V217A possibly damaging Het
Ankk1 A C 9: 49,415,850 H676Q probably benign Het
Arl1 G C 10: 88,733,546 probably benign Het
Asxl3 T A 18: 22,517,739 D928E probably damaging Het
AW209491 T C 13: 14,636,733 V57A possibly damaging Het
B3galt4 G T 17: 33,950,911 Q118K probably benign Het
Ccdc187 A T 2: 26,276,068 M783K probably benign Het
Cdon T G 9: 35,483,158 M900R probably damaging Het
Ceacam5 G A 7: 17,714,910 W67* probably null Het
Chd5 A G 4: 152,378,270 S1356G probably damaging Het
Chil3 C T 3: 106,148,801 probably null Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cntn1 C T 15: 92,305,140 R768C probably damaging Het
Col6a3 T A 1: 90,807,534 I798F possibly damaging Het
Cpxcr1 T A X: 116,478,061 L223* probably null Het
Cpz C A 5: 35,502,558 R581L possibly damaging Het
Cxcr2 A G 1: 74,159,279 I311V probably benign Het
Cym T A 3: 107,218,714 I78F probably benign Het
Defb8 A T 8: 19,445,883 S54T probably benign Het
Dennd4a A G 9: 64,862,030 T433A probably damaging Het
Dhx29 A G 13: 112,948,281 T678A probably damaging Het
Dspp T C 5: 104,174,085 probably null Het
Enkur G T 2: 21,189,177 A195E probably benign Het
Ero1lb T A 13: 12,604,403 S429T possibly damaging Het
Fh1 A G 1: 175,607,886 S344P probably damaging Het
Flnc G T 6: 29,443,479 G553V probably damaging Het
Fmo1 A T 1: 162,829,985 L529* probably null Het
Frem1 C A 4: 82,950,500 V1415F probably damaging Het
Gatb T G 3: 85,618,877 L354R probably damaging Het
Gdpgp1 A T 7: 80,238,601 N127Y probably damaging Het
Gm11492 T A 11: 87,568,915 D496E probably damaging Het
Gm13084 T C 4: 143,812,826 I32M probably benign Het
Gm13212 T G 4: 145,624,250 probably benign Het
Gpat2 A G 2: 127,434,819 T648A possibly damaging Het
Grk6 C T 13: 55,451,778 R225* probably null Het
Hells A T 19: 38,959,676 Q682L probably null Het
Hspa5 T A 2: 34,774,678 N381K possibly damaging Het
Ighmbp2 T C 19: 3,262,075 N893S probably benign Het
Ipo11 A T 13: 106,812,257 V914E possibly damaging Het
Lars T C 18: 42,212,608 N1001S probably benign Het
Lats2 A G 14: 57,697,455 L606P probably damaging Het
Map4k1 T C 7: 28,999,784 Y521H probably benign Het
March11 T A 15: 26,387,830 V257E probably damaging Het
Med23 G A 10: 24,910,870 probably null Het
Meltf A G 16: 31,896,577 D696G probably benign Het
Ms4a7 T A 19: 11,324,424 M212L probably benign Het
Mx1 A T 16: 97,448,203 L608Q probably damaging Het
Myh1 T C 11: 67,204,398 Y195H probably damaging Het
Napb G T 2: 148,706,989 H110Q probably benign Het
Ngly1 C T 14: 16,260,585 P90S probably damaging Het
Nlrp1b T A 11: 71,182,616 I134L possibly damaging Het
Nup210 A G 6: 91,016,054 L1017P probably damaging Het
Nup85 T A 11: 115,581,817 I233N probably damaging Het
Obsl1 A G 1: 75,492,893 V965A probably damaging Het
Olfr1259 A C 2: 89,943,814 Y100* probably null Het
Olfr1310 T C 2: 112,008,691 D165G probably benign Het
Olfr787 T C 10: 129,463,501 L275P probably damaging Het
Pak1ip1 A G 13: 41,011,232 T264A possibly damaging Het
Pard6g C T 18: 80,117,142 R157C probably damaging Het
Pcdhb7 A T 18: 37,342,578 T256S possibly damaging Het
Phrf1 T C 7: 141,240,918 F153L probably damaging Het
Pigw A T 11: 84,878,048 F152I probably damaging Het
Pip4k2c A G 10: 127,200,875 S222P probably damaging Het
Pjvk A G 2: 76,657,431 probably null Het
Plxnd1 C T 6: 115,963,914 V1355M probably damaging Het
Prss22 G A 17: 23,996,314 P163S probably damaging Het
Prune2 A G 19: 17,199,139 I154V probably damaging Het
Rapgef6 T A 11: 54,642,811 D362E probably benign Het
Retreg2 A G 1: 75,146,675 K416E probably benign Het
Scn7a T C 2: 66,680,291 I1256V probably benign Het
Sema4d A G 13: 51,711,222 V362A possibly damaging Het
Slc25a34 G A 4: 141,622,268 T192I probably benign Het
Tacc3 G T 5: 33,668,200 V425L probably benign Het
Tfdp2 A T 9: 96,297,709 K125I probably damaging Het
Tjp2 C T 19: 24,099,535 R952Q possibly damaging Het
Tk2 G T 8: 104,248,445 S30* probably null Het
Tmem74 A T 15: 43,867,163 D161E probably benign Het
Tmprss9 G A 10: 80,892,285 V570M probably damaging Het
Tnk2 C A 16: 32,679,462 P26Q probably damaging Het
Tnpo2 T G 8: 85,051,772 V610G probably damaging Het
Trim37 T C 11: 87,218,306 F953S probably damaging Het
U2surp T A 9: 95,482,097 K589* probably null Het
Usp2 G A 9: 44,075,966 R187H probably benign Het
Vmn2r1 C T 3: 64,101,505 T535I probably benign Het
Wdr20rt T A 12: 65,227,151 S463T possibly damaging Het
Zbtb25 C A 12: 76,349,714 G245W probably damaging Het
Zc3h14 T A 12: 98,760,354 L27* probably null Het
Zfp2 T C 11: 50,901,088 K43E probably benign Het
Zfp654 A G 16: 64,785,128 Y904H probably benign Het
Other mutations in Abi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Abi1 APN 2 22941930 missense possibly damaging 0.71
IGL01694:Abi1 APN 2 22960713 missense probably damaging 1.00
IGL01809:Abi1 APN 2 22946717 missense probably benign 0.00
IGL02189:Abi1 APN 2 23040064 start codon destroyed probably null 1.00
IGL03126:Abi1 APN 2 22953467 missense probably benign 0.12
IGL03213:Abi1 APN 2 22941959 missense probably damaging 1.00
IGL03325:Abi1 APN 2 22971228 missense probably damaging 1.00
R0421:Abi1 UTSW 2 22960827 missense probably damaging 1.00
R0505:Abi1 UTSW 2 22962504 splice site probably benign
R1265:Abi1 UTSW 2 22946722 missense possibly damaging 0.85
R2975:Abi1 UTSW 2 22957087 missense probably damaging 0.99
R3416:Abi1 UTSW 2 23040002 missense probably damaging 1.00
R5000:Abi1 UTSW 2 22950199 missense probably damaging 1.00
R5277:Abi1 UTSW 2 22994648 missense probably damaging 1.00
R5945:Abi1 UTSW 2 23039965 missense probably damaging 1.00
R6785:Abi1 UTSW 2 22953467 missense probably benign 0.12
R7000:Abi1 UTSW 2 22942041 missense probably damaging 1.00
R7249:Abi1 UTSW 2 22957089 missense possibly damaging 0.82
R7565:Abi1 UTSW 2 22946584 missense probably benign 0.00
R8052:Abi1 UTSW 2 22953543 missense probably benign 0.04
X0026:Abi1 UTSW 2 22971154 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGGTCAGTAATCATGCAGAC -3'
(R):5'- TGAGCACAGTGTGGCCTTAG -3'

Sequencing Primer
(F):5'- CTTCCGTTTCAGTAACACATAACTG -3'
(R):5'- CCTTAGGTTCTGTGGGGACAAAAAC -3'
Posted On2014-06-23