Incidental Mutation 'R1851:Ago1'
ID 208068
Institutional Source Beutler Lab
Gene Symbol Ago1
Ensembl Gene ENSMUSG00000041530
Gene Name argonaute RISC catalytic subunit 1
Synonyms Eif2c1, argonaute 1
MMRRC Submission 039875-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.751) question?
Stock # R1851 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 126435012-126468583 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 126439995 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 771 (R771L)
Ref Sequence ENSEMBL: ENSMUSP00000095498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]
AlphaFold Q8CJG1
Predicted Effect probably benign
Transcript: ENSMUST00000097888
AA Change: R771L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: R771L

DomainStartEndE-ValueType
Pfam:ArgoN 26 164 2.3e-26 PFAM
DUF1785 173 225 3.48e-25 SMART
PAZ 233 368 1.41e-5 SMART
Pfam:ArgoL2 373 418 3.6e-18 PFAM
Pfam:ArgoMid 427 509 7.6e-37 PFAM
Piwi 515 816 4.16e-131 SMART
Blast:Piwi 823 849 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156533
Predicted Effect probably benign
Transcript: ENSMUST00000176315
AA Change: R467L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530
AA Change: R467L

DomainStartEndE-ValueType
Pfam:PAZ 1 62 4.1e-23 PFAM
Piwi 211 512 4.16e-131 SMART
Blast:Piwi 519 545 2e-6 BLAST
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik A G 12: 18,533,686 E225G possibly damaging Het
Abcb7 T C X: 104,305,399 M153V probably benign Het
Abi1 A T 2: 22,950,264 V329D possibly damaging Het
Ablim3 G A 18: 61,849,395 H160Y probably benign Het
Acox3 A T 5: 35,609,062 D624V possibly damaging Het
Adam6b A G 12: 113,491,822 D753G probably benign Het
Aktip A G 8: 91,125,877 V217A possibly damaging Het
Ankk1 A C 9: 49,415,850 H676Q probably benign Het
Arl1 G C 10: 88,733,546 probably benign Het
Asxl3 T A 18: 22,517,739 D928E probably damaging Het
AW209491 T C 13: 14,636,733 V57A possibly damaging Het
B3galt4 G T 17: 33,950,911 Q118K probably benign Het
Ccdc187 A T 2: 26,276,068 M783K probably benign Het
Cdon T G 9: 35,483,158 M900R probably damaging Het
Ceacam5 G A 7: 17,714,910 W67* probably null Het
Chd5 A G 4: 152,378,270 S1356G probably damaging Het
Chil3 C T 3: 106,148,801 probably null Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cntn1 C T 15: 92,305,140 R768C probably damaging Het
Col6a3 T A 1: 90,807,534 I798F possibly damaging Het
Cpxcr1 T A X: 116,478,061 L223* probably null Het
Cpz C A 5: 35,502,558 R581L possibly damaging Het
Cxcr2 A G 1: 74,159,279 I311V probably benign Het
Cym T A 3: 107,218,714 I78F probably benign Het
Defb8 A T 8: 19,445,883 S54T probably benign Het
Dennd4a A G 9: 64,862,030 T433A probably damaging Het
Dhx29 A G 13: 112,948,281 T678A probably damaging Het
Dspp T C 5: 104,174,085 probably null Het
Enkur G T 2: 21,189,177 A195E probably benign Het
Ero1lb T A 13: 12,604,403 S429T possibly damaging Het
Fh1 A G 1: 175,607,886 S344P probably damaging Het
Flnc G T 6: 29,443,479 G553V probably damaging Het
Fmo1 A T 1: 162,829,985 L529* probably null Het
Frem1 C A 4: 82,950,500 V1415F probably damaging Het
Gatb T G 3: 85,618,877 L354R probably damaging Het
Gdpgp1 A T 7: 80,238,601 N127Y probably damaging Het
Gm11492 T A 11: 87,568,915 D496E probably damaging Het
Gm13084 T C 4: 143,812,826 I32M probably benign Het
Gm13212 T G 4: 145,624,250 probably benign Het
Gpat2 A G 2: 127,434,819 T648A possibly damaging Het
Grk6 C T 13: 55,451,778 R225* probably null Het
Hells A T 19: 38,959,676 Q682L probably null Het
Hspa5 T A 2: 34,774,678 N381K possibly damaging Het
Ighmbp2 T C 19: 3,262,075 N893S probably benign Het
Ipo11 A T 13: 106,812,257 V914E possibly damaging Het
Lars T C 18: 42,212,608 N1001S probably benign Het
Lats2 A G 14: 57,697,455 L606P probably damaging Het
Map4k1 T C 7: 28,999,784 Y521H probably benign Het
March11 T A 15: 26,387,830 V257E probably damaging Het
Med23 G A 10: 24,910,870 probably null Het
Meltf A G 16: 31,896,577 D696G probably benign Het
Ms4a7 T A 19: 11,324,424 M212L probably benign Het
Mx1 A T 16: 97,448,203 L608Q probably damaging Het
Myh1 T C 11: 67,204,398 Y195H probably damaging Het
Napb G T 2: 148,706,989 H110Q probably benign Het
Ngly1 C T 14: 16,260,585 P90S probably damaging Het
Nlrp1b T A 11: 71,182,616 I134L possibly damaging Het
Nup210 A G 6: 91,016,054 L1017P probably damaging Het
Nup85 T A 11: 115,581,817 I233N probably damaging Het
Obsl1 A G 1: 75,492,893 V965A probably damaging Het
Olfr1259 A C 2: 89,943,814 Y100* probably null Het
Olfr1310 T C 2: 112,008,691 D165G probably benign Het
Olfr787 T C 10: 129,463,501 L275P probably damaging Het
Pak1ip1 A G 13: 41,011,232 T264A possibly damaging Het
Pard6g C T 18: 80,117,142 R157C probably damaging Het
Pcdhb7 A T 18: 37,342,578 T256S possibly damaging Het
Phrf1 T C 7: 141,240,918 F153L probably damaging Het
Pigw A T 11: 84,878,048 F152I probably damaging Het
Pip4k2c A G 10: 127,200,875 S222P probably damaging Het
Pjvk A G 2: 76,657,431 probably null Het
Plxnd1 C T 6: 115,963,914 V1355M probably damaging Het
Prss22 G A 17: 23,996,314 P163S probably damaging Het
Prune2 A G 19: 17,199,139 I154V probably damaging Het
Rapgef6 T A 11: 54,642,811 D362E probably benign Het
Retreg2 A G 1: 75,146,675 K416E probably benign Het
Scn7a T C 2: 66,680,291 I1256V probably benign Het
Sema4d A G 13: 51,711,222 V362A possibly damaging Het
Slc25a34 G A 4: 141,622,268 T192I probably benign Het
Tacc3 G T 5: 33,668,200 V425L probably benign Het
Tfdp2 A T 9: 96,297,709 K125I probably damaging Het
Tjp2 C T 19: 24,099,535 R952Q possibly damaging Het
Tk2 G T 8: 104,248,445 S30* probably null Het
Tmem74 A T 15: 43,867,163 D161E probably benign Het
Tmprss9 G A 10: 80,892,285 V570M probably damaging Het
Tnk2 C A 16: 32,679,462 P26Q probably damaging Het
Tnpo2 T G 8: 85,051,772 V610G probably damaging Het
Trim37 T C 11: 87,218,306 F953S probably damaging Het
U2surp T A 9: 95,482,097 K589* probably null Het
Usp2 G A 9: 44,075,966 R187H probably benign Het
Vmn2r1 C T 3: 64,101,505 T535I probably benign Het
Wdr20rt T A 12: 65,227,151 S463T possibly damaging Het
Zbtb25 C A 12: 76,349,714 G245W probably damaging Het
Zc3h14 T A 12: 98,760,354 L27* probably null Het
Zfp2 T C 11: 50,901,088 K43E probably benign Het
Zfp654 A G 16: 64,785,128 Y904H probably benign Het
Other mutations in Ago1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Ago1 APN 4 126459817 missense probably damaging 0.98
IGL02578:Ago1 APN 4 126439531 missense probably benign 0.12
IGL02709:Ago1 APN 4 126453640 nonsense probably null
IGL02810:Ago1 APN 4 126443093 missense probably benign 0.00
IGL03037:Ago1 APN 4 126461794 missense probably benign 0.00
IGL03091:Ago1 APN 4 126459189 missense probably damaging 0.98
IGL03100:Ago1 APN 4 126443171 missense probably benign 0.08
IGL03121:Ago1 APN 4 126460003 missense probably benign 0.00
R0195:Ago1 UTSW 4 126463691 missense probably benign 0.01
R0244:Ago1 UTSW 4 126463706 missense possibly damaging 0.94
R0309:Ago1 UTSW 4 126443166 missense probably benign 0.06
R0514:Ago1 UTSW 4 126439595 missense probably benign
R0557:Ago1 UTSW 4 126460024 missense probably benign 0.00
R1104:Ago1 UTSW 4 126453633 missense probably damaging 0.99
R1553:Ago1 UTSW 4 126440401 missense probably damaging 0.99
R1624:Ago1 UTSW 4 126463741 missense probably damaging 0.97
R1867:Ago1 UTSW 4 126441236 missense probably damaging 0.98
R2001:Ago1 UTSW 4 126454394 missense probably null 0.36
R2051:Ago1 UTSW 4 126460453 missense probably benign 0.01
R2057:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R2105:Ago1 UTSW 4 126461788 missense probably benign 0.30
R2117:Ago1 UTSW 4 126463857 splice site probably null
R2256:Ago1 UTSW 4 126441911 missense possibly damaging 0.80
R2272:Ago1 UTSW 4 126453650 missense probably benign 0.01
R2517:Ago1 UTSW 4 126439939 nonsense probably null
R2850:Ago1 UTSW 4 126443075 splice site probably benign
R2993:Ago1 UTSW 4 126440046 splice site probably benign
R3746:Ago1 UTSW 4 126461044 missense probably benign
R3747:Ago1 UTSW 4 126461044 missense probably benign
R3750:Ago1 UTSW 4 126461044 missense probably benign
R4600:Ago1 UTSW 4 126460392 missense probably benign 0.37
R4934:Ago1 UTSW 4 126448859 missense possibly damaging 0.56
R4983:Ago1 UTSW 4 126453654 missense probably damaging 0.99
R5086:Ago1 UTSW 4 126453604 missense probably benign 0.01
R5132:Ago1 UTSW 4 126461723 missense probably benign 0.01
R5239:Ago1 UTSW 4 126441215 missense probably damaging 1.00
R5609:Ago1 UTSW 4 126461037 missense possibly damaging 0.80
R5705:Ago1 UTSW 4 126448794 missense probably benign 0.01
R5980:Ago1 UTSW 4 126460569 unclassified probably benign
R6036:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R6036:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R6398:Ago1 UTSW 4 126448808 missense probably benign 0.26
R6505:Ago1 UTSW 4 126463835 missense probably benign 0.00
R6545:Ago1 UTSW 4 126454352 missense possibly damaging 0.74
R6944:Ago1 UTSW 4 126460422 missense possibly damaging 0.78
R7041:Ago1 UTSW 4 126463706 missense possibly damaging 0.94
R7490:Ago1 UTSW 4 126439505 makesense probably null
R7496:Ago1 UTSW 4 126461752 missense probably benign 0.20
R7575:Ago1 UTSW 4 126453908 missense probably benign 0.12
R7625:Ago1 UTSW 4 126443229 missense probably benign 0.18
R7988:Ago1 UTSW 4 126460417 missense probably damaging 1.00
R8041:Ago1 UTSW 4 126441936 missense probably damaging 1.00
R8073:Ago1 UTSW 4 126443226 missense probably benign 0.04
R8086:Ago1 UTSW 4 126460981 missense probably benign
R8127:Ago1 UTSW 4 126454421 missense possibly damaging 0.95
R8772:Ago1 UTSW 4 126460523 unclassified probably benign
R8878:Ago1 UTSW 4 126463723 missense probably benign 0.35
R8989:Ago1 UTSW 4 126463790 missense probably benign 0.01
R9140:Ago1 UTSW 4 126443184 missense probably benign
X0025:Ago1 UTSW 4 126443115 missense possibly damaging 0.47
Z1177:Ago1 UTSW 4 126453656 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAACAGCTAGCCTTTACCTGTC -3'
(R):5'- CCATTAGCTAGCCCCAAGTGTAC -3'

Sequencing Primer
(F):5'- GTCATGTTCCTTGTCCACCAGG -3'
(R):5'- GGTATGGTCATGCAACCTAAAC -3'
Posted On 2014-06-23